Incidental Mutation 'R0563:Megf8'
ID46006
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25342395 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1245 (C1245R)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably damaging
Transcript: ENSMUST00000128119
AA Change: C1245R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: C1245R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153077
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTGGCAGCTTTGGCAATGCAAC -3'
(R):5'- TTCTGTGGCAGAGACAACCCACAC -3'

Sequencing Primer
(F):5'- ATGCAACCGGCTCTGGTG -3'
(R):5'- GCCACCGAGGACACATTG -3'
Posted On2013-06-11