Incidental Mutation 'R5935:Zfc3h1'
ID462196
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Namezinc finger, C3H1-type containing
SynonymsCcdc131, Psrc2
MMRRC Submission 044129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R5935 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115384959-115432772 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 115431357 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
Predicted Effect probably benign
Transcript: ENSMUST00000036044
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143751
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (92/96)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,465 L230P probably benign Het
6430531B16Rik G A 7: 139,976,613 H154Y probably benign Het
Adam26b C G 8: 43,521,298 M222I probably benign Het
Ahnak T C 19: 9,015,182 V4610A possibly damaging Het
Ankrd13c C T 3: 157,947,583 silent Het
Cables2 A G 2: 180,262,048 probably benign Het
Cabp2 C A 19: 4,086,497 A181D probably damaging Het
Camsap3 A G 8: 3,601,999 D265G probably damaging Het
Cbs G T 17: 31,632,879 T50N probably damaging Het
Ccdc129 A T 6: 55,897,769 R235* probably null Het
Cenpa A T 5: 30,673,037 Q83L possibly damaging Het
Cit A T 5: 115,925,539 probably benign Het
Ckap5 A G 2: 91,615,100 E1694G possibly damaging Het
Copz1 A T 15: 103,294,770 M104L probably benign Het
Crot T A 5: 8,974,192 M335L probably benign Het
Ctnna2 T C 6: 77,143,921 D373G probably benign Het
Ctu2 G A 8: 122,476,954 probably benign Het
Cyp3a59 T A 5: 146,090,645 Y75* probably null Het
Dbi A G 1: 120,120,853 I21T probably benign Het
Dcun1d3 A G 7: 119,859,576 S79P probably benign Het
Dock10 T A 1: 80,505,587 probably benign Het
Dstyk T A 1: 132,454,137 I543N probably damaging Het
Epx G T 11: 87,865,492 A621E probably damaging Het
Farp2 G A 1: 93,620,645 probably null Het
Gm11992 C T 11: 9,052,711 P25S probably damaging Het
Grik5 A T 7: 25,059,077 M307K possibly damaging Het
Hnf1b A T 11: 83,882,677 N234I probably damaging Het
Htr2a A G 14: 74,645,090 D172G probably damaging Het
Ifit1bl2 T C 19: 34,619,728 T163A probably benign Het
Igsf10 A T 3: 59,328,157 D1534E probably benign Het
Il3ra T G 14: 14,350,799 V178G probably damaging Het
Itgb1 A T 8: 128,713,237 K136* probably null Het
Lama2 T A 10: 27,015,498 I2540F probably benign Het
Lrp8 C A 4: 107,857,296 H622Q probably damaging Het
Lrrc2 T A 9: 110,966,561 M138K probably benign Het
Lrrk2 C A 15: 91,745,831 H1242N probably benign Het
Lsm11 G C 11: 45,944,618 R99G probably benign Het
Mif4gd C T 11: 115,609,613 V40M probably benign Het
Mpp3 A T 11: 102,025,415 V37D probably damaging Het
Mre11a T A 9: 14,786,962 D35E probably damaging Het
Mroh4 C A 15: 74,621,154 V233F probably damaging Het
Npy2r A T 3: 82,540,761 S123T possibly damaging Het
Nrip2 A G 6: 128,408,398 Y264C possibly damaging Het
Obscn A G 11: 59,006,813 S6639P unknown Het
Olfr574 T A 7: 102,948,810 F105Y probably benign Het
Olfr963 C T 9: 39,669,090 T11I probably benign Het
Osbpl5 C T 7: 143,756,958 probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pcdhb8 A G 18: 37,356,190 D307G probably damaging Het
Pde1b A G 15: 103,521,439 K120E possibly damaging Het
Pdzrn4 T C 15: 92,397,374 S154P probably benign Het
Ppp1r13b T C 12: 111,830,442 K889R probably benign Het
Ppp4r3a T A 12: 101,051,613 D439V probably damaging Het
Ptk2b A G 14: 66,173,879 I401T probably damaging Het
Rab24 T C 13: 55,320,530 T153A probably damaging Het
Rarb C A 14: 16,434,264 A305S probably damaging Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Scn10a G A 9: 119,627,171 T1194I probably damaging Het
Scn3a G T 2: 65,464,836 N1514K probably damaging Het
Serpinb3d T C 1: 107,083,375 T36A probably benign Het
Shisa5 T A 9: 109,056,683 M229K possibly damaging Het
Sik2 C T 9: 50,917,131 G204R probably damaging Het
Sla C T 15: 66,793,705 G46E probably damaging Het
Slc35g3 A T 11: 69,761,683 M1K probably null Het
Slc5a7 A T 17: 54,276,944 Y439* probably null Het
Slc9a1 T C 4: 133,419,865 probably benign Het
Slitrk6 T G 14: 110,749,873 T801P probably benign Het
Spata31d1c T C 13: 65,037,080 V812A possibly damaging Het
Sphkap A C 1: 83,339,599 L59R probably damaging Het
Srsf10 C A 4: 135,856,242 R6S probably damaging Het
Supt5 T A 7: 28,329,475 R131S probably benign Het
Syne1 T C 10: 5,360,706 probably null Het
Tepp A T 8: 95,319,992 T98S possibly damaging Het
Tet2 T A 3: 133,488,535 H46L possibly damaging Het
Tnfsf4 T A 1: 161,417,248 N169K probably damaging Het
Tprg A T 16: 25,317,261 M1L possibly damaging Het
Tsen2 A G 6: 115,559,595 Y104C probably damaging Het
Ttc6 A G 12: 57,673,804 Y952C probably damaging Het
Umod A T 7: 119,471,427 I414N probably damaging Het
Usp10 G T 8: 119,947,089 V398L possibly damaging Het
Vmn2r23 A T 6: 123,741,895 I736F possibly damaging Het
Vmn2r65 C A 7: 84,943,661 G446V probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Yars2 A G 16: 16,309,471 I467V probably benign Het
Ykt6 A G 11: 5,959,338 E49G possibly damaging Het
Zan T A 5: 137,443,930 M1907L unknown Het
Zdhhc2 T C 8: 40,464,236 S225P probably damaging Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115419832 missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115416874 missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115423448 missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115423223 missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115427099 missense probably benign
IGL02382:Zfc3h1 APN 10 115416876 nonsense probably null
IGL02397:Zfc3h1 APN 10 115407985 missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115411954 missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115400904 missense probably benign 0.42
gnatcatcher UTSW 10 115400742 missense probably benign 0.39
vireo UTSW 10 115419901 missense probably benign 0.01
warbler UTSW 10 115406483 missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115390889 missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115427039 nonsense probably null
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115415287 missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115406725 splice site probably benign
R0355:Zfc3h1 UTSW 10 115409113 missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115420810 missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115410632 missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115401707 missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115427716 missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115411961 missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115412108 missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115416742 missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115390922 missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115406901 splice site probably null
R1959:Zfc3h1 UTSW 10 115423253 missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115406483 missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115410523 splice site probably benign
R3691:Zfc3h1 UTSW 10 115420690 missense probably benign
R3909:Zfc3h1 UTSW 10 115419901 missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115418799 missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115423385 missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115415694 missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115400742 missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115410642 missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115404211 missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5069:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5070:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5155:Zfc3h1 UTSW 10 115412121 missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115418692 missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115410693 missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115400910 missense probably benign 0.44
R6165:Zfc3h1 UTSW 10 115420669 missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115390859 missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115413976 missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115407908 missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115401748 missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115412002 missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115420733 missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115403300 missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115424630 missense probably benign
R7404:Zfc3h1 UTSW 10 115415248 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTTCACACACTGGTCTGC -3'
(R):5'- AAACATGGCTCTCTTGGGCTTTAG -3'

Sequencing Primer
(F):5'- ACTGGTCTGCTTTATTCCTGTAAAG -3'
(R):5'- TCTTGGGCTTTAGAGATTTCAAATAG -3'
Posted On2017-02-28