Incidental Mutation 'R0568:Smc4'
ID46250
Institutional Source Beutler Lab
Gene Symbol Smc4
Ensembl Gene ENSMUSG00000034349
Gene Namestructural maintenance of chromosomes 4
Synonyms2500002A22Rik, Smc4l1
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69004738-69034623 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 69022461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042901] [ENSMUST00000107803] [ENSMUST00000136502] [ENSMUST00000148385] [ENSMUST00000195525]
Predicted Effect probably null
Transcript: ENSMUST00000042901
SMART Domains Protein: ENSMUSP00000047872
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
PDB:1W1W|D 89 238 1e-17 PDB
Blast:AAA 104 238 3e-6 BLAST
low complexity region 408 427 N/A INTRINSIC
low complexity region 447 460 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
SMC_hinge 611 726 1.12e-31 SMART
low complexity region 870 881 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
Blast:AAA 1102 1276 5e-26 BLAST
PDB:3KTA|D 1125 1276 3e-30 PDB
SCOP:d1e69a_ 1188 1263 3e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107803
SMART Domains Protein: ENSMUSP00000103433
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
Pfam:AAA_23 59 329 1.3e-12 PFAM
Pfam:AAA_21 81 199 5.2e-7 PFAM
coiled coil region 369 482 N/A INTRINSIC
coiled coil region 511 563 N/A INTRINSIC
SMC_hinge 586 701 8.6e-36 SMART
Pfam:SMC_N 738 1247 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128134
Predicted Effect probably benign
Transcript: ENSMUST00000136502
SMART Domains Protein: ENSMUSP00000115033
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
Pfam:SMC_N 81 303 1.2e-42 PFAM
Pfam:AAA_23 84 336 2.6e-16 PFAM
Pfam:AAA_21 106 227 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148385
Predicted Effect probably benign
Transcript: ENSMUST00000149174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194693
Predicted Effect probably benign
Transcript: ENSMUST00000195525
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the 'structural maintenance of chromosomes' (SMC) gene family. Members of this gene family play a role in two changes in chromosome structure during mitotic segregation of chromosomes- chromosome condensation and sister chromatid cohesion. The protein encoded by this gene is likely a subunit of the 13S condensin complex, which is involved in chromosome condensation. A pseudogene related to this gene is located on chromosome 2. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Smc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Smc4 APN 3 69030379 missense probably damaging 0.98
IGL00542:Smc4 APN 3 69028438 splice site probably benign
IGL01104:Smc4 APN 3 69027584 missense possibly damaging 0.95
IGL01380:Smc4 APN 3 69025828 missense probably damaging 1.00
IGL01397:Smc4 APN 3 69031544 missense probably benign
IGL02441:Smc4 APN 3 69006211 missense probably damaging 1.00
IGL02629:Smc4 APN 3 69025873 missense probably damaging 0.96
IGL03220:Smc4 APN 3 69009542 missense possibly damaging 0.67
pyrrhic UTSW 3 69027502 missense probably damaging 1.00
R0452:Smc4 UTSW 3 69008028 nonsense probably null
R0523:Smc4 UTSW 3 69025888 missense probably damaging 1.00
R0571:Smc4 UTSW 3 69024289 missense probably damaging 1.00
R0602:Smc4 UTSW 3 69009538 missense probably damaging 1.00
R0925:Smc4 UTSW 3 69006215 critical splice donor site probably benign
R0963:Smc4 UTSW 3 69025926 missense probably damaging 1.00
R1540:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R1755:Smc4 UTSW 3 69034108 missense probably damaging 1.00
R1920:Smc4 UTSW 3 69033068 missense probably damaging 1.00
R4226:Smc4 UTSW 3 69031467 missense probably benign 0.01
R4510:Smc4 UTSW 3 69016647 splice site probably null
R4511:Smc4 UTSW 3 69016647 splice site probably null
R4899:Smc4 UTSW 3 69031811 missense probably damaging 0.97
R4967:Smc4 UTSW 3 69018239 intron probably benign
R5096:Smc4 UTSW 3 69021279 missense probably damaging 1.00
R5101:Smc4 UTSW 3 69028512 missense probably benign 0.00
R5588:Smc4 UTSW 3 69025857 missense probably benign
R5631:Smc4 UTSW 3 69030312 missense probably benign 0.16
R5633:Smc4 UTSW 3 69008110 missense probably damaging 1.00
R6229:Smc4 UTSW 3 69030247 nonsense probably null
R6300:Smc4 UTSW 3 69027891 missense probably benign 0.00
R6554:Smc4 UTSW 3 69029515 missense probably benign 0.00
R6596:Smc4 UTSW 3 69025893 missense probably damaging 1.00
R6603:Smc4 UTSW 3 69022461 critical splice donor site probably null
R6682:Smc4 UTSW 3 69007241 missense probably damaging 0.98
R6727:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R6955:Smc4 UTSW 3 69024309 missense possibly damaging 0.95
R7037:Smc4 UTSW 3 69018195 missense possibly damaging 0.67
R7051:Smc4 UTSW 3 69027502 missense probably damaging 1.00
R7454:Smc4 UTSW 3 69018124 missense probably benign
X0063:Smc4 UTSW 3 69018103 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCAAAGATGGAAGTTGCTCAGTCAGAAC -3'
(R):5'- GGAGGTGGTGGGGATGTCTAACTAA -3'

Sequencing Primer
(F):5'- TCAGAACTTGATATCTATCTCAGTCG -3'
(R):5'- agccatctctccagccc -3'
Posted On2013-06-11