Incidental Mutation 'R6010:Gm7247'
ID479727
Institutional Source Beutler Lab
Gene Symbol Gm7247
Ensembl Gene ENSMUSG00000068399
Gene Namepredicted gene 7247
Synonyms
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location51361756-51569982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51364348 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 26 (S26F)
Ref Sequence ENSEMBL: ENSMUSP00000125409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162998]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162079
Predicted Effect probably benign
Transcript: ENSMUST00000162998
AA Change: S26F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399
AA Change: S26F

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228571
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Gm7247
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gm7247 APN 14 51523505 missense possibly damaging 0.73
IGL01776:Gm7247 APN 14 51521899 missense possibly damaging 0.86
IGL01836:Gm7247 APN 14 51365396 missense probably damaging 1.00
IGL02270:Gm7247 APN 14 51521884 missense probably benign 0.10
IGL02961:Gm7247 APN 14 51365355 missense probably damaging 1.00
IGL03390:Gm7247 APN 14 51523457 missense probably benign
R0054:Gm7247 UTSW 14 51569600 utr 3 prime probably benign
R0413:Gm7247 UTSW 14 51523472 missense probably benign 0.33
R1143:Gm7247 UTSW 14 51523418 missense probably benign 0.33
R2018:Gm7247 UTSW 14 51365347 missense possibly damaging 0.60
R2019:Gm7247 UTSW 14 51365347 missense possibly damaging 0.60
R2117:Gm7247 UTSW 14 51365335 missense probably damaging 0.99
R3971:Gm7247 UTSW 14 51365384 missense probably damaging 1.00
R4649:Gm7247 UTSW 14 51569594 critical splice acceptor site probably null
R5109:Gm7247 UTSW 14 51365317 missense probably damaging 0.98
R5773:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5775:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5776:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5994:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5995:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5996:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6008:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6009:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6011:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6193:Gm7247 UTSW 14 51521842 missense possibly damaging 0.89
R6986:Gm7247 UTSW 14 51365375 missense possibly damaging 0.95
R7226:Gm7247 UTSW 14 51365351 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCTTCCTTGGAAAATCTCCTG -3'
(R):5'- GGTCTGTCATTAAGAAAGTCCAAG -3'

Sequencing Primer
(F):5'- CCTTGGAAAATCTCCTGTATCTAGG -3'
(R):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
Posted On2017-06-26