Incidental Mutation 'R6013:Sptbn4'
ID 479848
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Name spectrin beta, non-erythrocytic 4
Synonyms nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4
MMRRC Submission 044189-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R6013 (G1)
Quality Score 205.009
Status Not validated
Chromosome 7
Chromosomal Location 27055808-27147111 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27063904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 2174 (L2174P)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
AlphaFold E9PX29
Predicted Effect probably damaging
Transcript: ENSMUST00000011895
AA Change: L2179P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: L2179P

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108362
AA Change: L859P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: L859P

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108363
AA Change: L859P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: L859P

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108364
AA Change: L859P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: L859P

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172269
AA Change: L2174P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: L2174P

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C T 3: 6,682,310 (GRCm39) probably null Het
Aanat A T 11: 116,486,950 (GRCm39) probably null Het
Abca17 A T 17: 24,506,820 (GRCm39) V1178E possibly damaging Het
Abcf3 T A 16: 20,369,311 (GRCm39) probably null Het
Alk A G 17: 72,207,732 (GRCm39) M1001T probably benign Het
Arhgap23 C A 11: 97,391,818 (GRCm39) S1445Y probably damaging Het
Atp10a T C 7: 58,447,538 (GRCm39) I760T probably benign Het
Cadm1 C T 9: 47,768,572 (GRCm39) probably benign Het
Car10 A T 11: 93,076,105 (GRCm39) probably benign Het
Casq2 G T 3: 102,052,945 (GRCm39) probably null Het
Cemip2 G A 19: 21,809,403 (GRCm39) V928I possibly damaging Het
Clec4f T C 6: 83,632,070 (GRCm39) I55V probably benign Het
Cngb1 T C 8: 96,010,949 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,972,098 (GRCm39) probably null Het
Cyp2c39 A C 19: 39,501,969 (GRCm39) R119S probably benign Het
Cyp4f16 C T 17: 32,765,652 (GRCm39) A345V probably null Het
Ddx43 T C 9: 78,321,567 (GRCm39) L412S probably damaging Het
Dnajb12 G A 10: 59,730,163 (GRCm39) probably null Het
Ephx2 A G 14: 66,347,691 (GRCm39) S56P probably benign Het
Fam83h A G 15: 75,875,849 (GRCm39) F496S probably damaging Het
Gcnt4 T C 13: 97,083,786 (GRCm39) S361P possibly damaging Het
H2-T23 G T 17: 36,341,474 (GRCm39) H332Q probably benign Het
Hrob T C 11: 102,145,859 (GRCm39) V45A probably benign Het
Ift57 G T 16: 49,519,667 (GRCm39) probably null Het
Il1rl2 A G 1: 40,391,017 (GRCm39) H320R possibly damaging Het
Kansl1 A G 11: 104,241,465 (GRCm39) V618A probably benign Het
Kctd3 T C 1: 188,728,665 (GRCm39) E157G probably benign Het
Magohb T A 6: 131,270,037 (GRCm39) D31V possibly damaging Het
Mdn1 C A 4: 32,715,713 (GRCm39) F1993L probably damaging Het
Med29 C A 7: 28,086,418 (GRCm39) C130F probably benign Het
Mtmr7 G A 8: 41,034,570 (GRCm39) R251C probably damaging Het
Ncor1 T C 11: 62,211,903 (GRCm39) I49V probably benign Het
Nfkb1 G T 3: 135,332,445 (GRCm39) T109K possibly damaging Het
Pkd1l1 A G 11: 8,819,452 (GRCm39) probably null Het
Pkp1 T A 1: 135,811,648 (GRCm39) T408S probably damaging Het
Plec A T 15: 76,073,510 (GRCm39) D501E possibly damaging Het
Prcp A C 7: 92,576,976 (GRCm39) Y335S possibly damaging Het
Reg2 T A 6: 78,384,952 (GRCm39) Y165N possibly damaging Het
Rnf7 T C 9: 96,353,787 (GRCm39) *114W probably null Het
Scg3 T C 9: 75,584,090 (GRCm39) D137G probably damaging Het
Serpinb7 T C 1: 107,377,919 (GRCm39) V204A probably benign Het
Sez6 C T 11: 77,864,623 (GRCm39) H528Y probably damaging Het
Sf3b1 A T 1: 55,039,457 (GRCm39) S723T probably damaging Het
Shtn1 T C 19: 58,963,533 (GRCm39) D594G probably damaging Het
Stk25 A G 1: 93,553,181 (GRCm39) probably null Het
Tep1 A T 14: 51,098,505 (GRCm39) F429I probably damaging Het
Thada T A 17: 84,580,228 (GRCm39) I1409F probably benign Het
Usp25 G A 16: 76,873,909 (GRCm39) G495E probably benign Het
Washc2 A G 6: 116,231,114 (GRCm39) S844G probably damaging Het
Xirp2 A T 2: 67,341,287 (GRCm39) H1176L possibly damaging Het
Ypel1 T C 16: 16,918,129 (GRCm39) N96D probably damaging Het
Zfand6 C A 7: 84,281,900 (GRCm39) V110L probably benign Het
Zfp30 A G 7: 29,488,846 (GRCm39) R8G possibly damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27,068,859 (GRCm39) missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27,117,390 (GRCm39) missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27,114,196 (GRCm39) missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27,103,693 (GRCm39) missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27,063,571 (GRCm39) missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27,063,940 (GRCm39) missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27,063,782 (GRCm39) missense probably benign
IGL02226:Sptbn4 APN 7 27,065,132 (GRCm39) missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27,063,724 (GRCm39) missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27,127,672 (GRCm39) missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27,065,014 (GRCm39) missense probably null 0.15
IGL02487:Sptbn4 APN 7 27,118,522 (GRCm39) missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27,090,976 (GRCm39) missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27,067,104 (GRCm39) missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27,093,573 (GRCm39) splice site probably benign
IGL02961:Sptbn4 APN 7 27,097,392 (GRCm39) missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27,056,812 (GRCm39) nonsense probably null
R0194:Sptbn4 UTSW 7 27,104,336 (GRCm39) missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27,059,161 (GRCm39) splice site probably benign
R0510:Sptbn4 UTSW 7 27,060,991 (GRCm39) critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27,063,803 (GRCm39) missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27,107,753 (GRCm39) nonsense probably null
R1336:Sptbn4 UTSW 7 27,117,388 (GRCm39) missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27,133,719 (GRCm39) missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27,118,164 (GRCm39) missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27,118,008 (GRCm39) missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27,066,071 (GRCm39) missense probably null 0.96
R1906:Sptbn4 UTSW 7 27,090,856 (GRCm39) critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27,106,563 (GRCm39) missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27,065,868 (GRCm39) missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27,123,235 (GRCm39) missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27,065,844 (GRCm39) nonsense probably null
R2083:Sptbn4 UTSW 7 27,127,681 (GRCm39) missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27,063,587 (GRCm39) missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27,067,034 (GRCm39) missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27,059,517 (GRCm39) missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27,117,523 (GRCm39) nonsense probably null
R4115:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27,117,896 (GRCm39) missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27,123,223 (GRCm39) missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27,066,160 (GRCm39) missense possibly damaging 0.60
R4684:Sptbn4 UTSW 7 27,063,844 (GRCm39) missense probably damaging 0.96
R4707:Sptbn4 UTSW 7 27,116,431 (GRCm39) missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27,071,577 (GRCm39) missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27,068,816 (GRCm39) missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27,059,166 (GRCm39) critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27,065,853 (GRCm39) missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27,118,138 (GRCm39) missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27,103,678 (GRCm39) missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27,071,596 (GRCm39) missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27,118,024 (GRCm39) missense probably damaging 1.00
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27,059,513 (GRCm39) missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27,064,012 (GRCm39) nonsense probably null
R6762:Sptbn4 UTSW 7 27,093,633 (GRCm39) missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27,071,375 (GRCm39) missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27,117,481 (GRCm39) missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27,116,210 (GRCm39) missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27,066,114 (GRCm39) missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27,108,439 (GRCm39) missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27,127,693 (GRCm39) missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27,075,015 (GRCm39) missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27,141,960 (GRCm39) missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27,071,697 (GRCm39) missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27,061,002 (GRCm39) missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27,063,761 (GRCm39) missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27,061,059 (GRCm39) missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27,061,835 (GRCm39) missense probably benign
R8002:Sptbn4 UTSW 7 27,117,417 (GRCm39) missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27,063,694 (GRCm39) missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27,074,808 (GRCm39) missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27,108,314 (GRCm39) nonsense probably null
R8353:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27,071,721 (GRCm39) missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8815:Sptbn4 UTSW 7 27,106,657 (GRCm39) nonsense probably null
R8818:Sptbn4 UTSW 7 27,063,592 (GRCm39) missense possibly damaging 0.71
R9171:Sptbn4 UTSW 7 27,141,844 (GRCm39) missense possibly damaging 0.95
R9259:Sptbn4 UTSW 7 27,067,124 (GRCm39) missense possibly damaging 0.74
R9477:Sptbn4 UTSW 7 27,132,624 (GRCm39) missense possibly damaging 0.79
R9564:Sptbn4 UTSW 7 27,117,504 (GRCm39) missense probably damaging 0.98
R9572:Sptbn4 UTSW 7 27,066,095 (GRCm39) missense probably benign 0.16
R9623:Sptbn4 UTSW 7 27,107,807 (GRCm39) missense probably damaging 1.00
R9715:Sptbn4 UTSW 7 27,091,000 (GRCm39) missense probably damaging 1.00
R9782:Sptbn4 UTSW 7 27,107,993 (GRCm39) missense probably benign 0.02
R9790:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9791:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9798:Sptbn4 UTSW 7 27,056,717 (GRCm39) makesense probably null
X0020:Sptbn4 UTSW 7 27,102,159 (GRCm39) critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27,056,736 (GRCm39) unclassified probably benign
Z1176:Sptbn4 UTSW 7 27,059,450 (GRCm39) missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27,108,527 (GRCm39) missense probably benign 0.41
Z1177:Sptbn4 UTSW 7 27,104,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGTTGATCCACGGACTC -3'
(R):5'- TCCCAGATCGAGAAACTCAAGG -3'

Sequencing Primer
(F):5'- GGACTCCTGGCGTTCTGATC -3'
(R):5'- TCGAGAAACTCAAGGCAGAAC -3'
Posted On 2017-06-26