Incidental Mutation 'R6025:Kcnq1'
ID479976
Institutional Source Beutler Lab
Gene Symbol Kcnq1
Ensembl Gene ENSMUSG00000009545
Gene Namepotassium voltage-gated channel, subfamily Q, member 1
SynonymsKVLQT1, Kcna9
MMRRC Submission 044197-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6025 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143106362-143427042 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 143106433 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009689] [ENSMUST00000185383] [ENSMUST00000186284] [ENSMUST00000186288] [ENSMUST00000186488] [ENSMUST00000186798] [ENSMUST00000187213]
Predicted Effect probably benign
Transcript: ENSMUST00000009689
SMART Domains Protein: ENSMUSP00000009689
Gene: ENSMUSG00000009545

DomainStartEndE-ValueType
Pfam:Ion_trans 121 358 7.5e-28 PFAM
Pfam:Ion_trans_2 261 351 5.9e-13 PFAM
low complexity region 404 427 N/A INTRINSIC
Pfam:KCNQ_channel 480 624 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185383
SMART Domains Protein: ENSMUSP00000139548
Gene: ENSMUSG00000009545

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Ion_trans 93 282 1.4e-23 PFAM
Pfam:Ion_trans_2 198 287 1.2e-11 PFAM
low complexity region 340 363 N/A INTRINSIC
low complexity region 422 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186284
Predicted Effect probably benign
Transcript: ENSMUST00000186288
Predicted Effect unknown
Transcript: ENSMUST00000186488
AA Change: W24R
SMART Domains Protein: ENSMUSP00000140673
Gene: ENSMUSG00000009545
AA Change: W24R

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186798
Predicted Effect probably benign
Transcript: ENSMUST00000187213
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous targeted null or spontaneous mutants show circling and head-tossing behavior and are deaf with inner ear dysmorphology. Paternal inheritance of a deletion of an imprinted control region within an intron of this gene results in small body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dctn1 T A 6: 83,193,691 probably null Het
Dgkz T C 2: 91,945,910 T3A possibly damaging Het
Duoxa2 T C 2: 122,301,851 S249P possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fam71e2 T A 7: 4,758,144 D523V probably benign Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Lonp2 G T 8: 86,713,373 G247V probably damaging Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Stxbp5 T A 10: 9,800,028 T616S probably benign Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tns3 A T 11: 8,492,578 M595K possibly damaging Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Kcnq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Kcnq1 APN 7 143194278 nonsense probably null
IGL01936:Kcnq1 APN 7 143184504 missense possibly damaging 0.83
IGL02134:Kcnq1 APN 7 143183716 missense possibly damaging 0.66
IGL02613:Kcnq1 APN 7 143426126 unclassified probably benign
R0841:Kcnq1 UTSW 7 143107452 missense probably benign 0.07
R1843:Kcnq1 UTSW 7 143183120 missense probably benign 0.03
R2571:Kcnq1 UTSW 7 143107696 missense probably benign 0.35
R2910:Kcnq1 UTSW 7 143425962 missense probably damaging 1.00
R3943:Kcnq1 UTSW 7 143426088 missense probably damaging 1.00
R4274:Kcnq1 UTSW 7 143184442 missense probably damaging 1.00
R4686:Kcnq1 UTSW 7 143107729 missense probably benign 0.44
R4795:Kcnq1 UTSW 7 143182757 missense probably benign 0.01
R5133:Kcnq1 UTSW 7 143194346 critical splice donor site probably null
R5151:Kcnq1 UTSW 7 143426012 missense probably benign
R5658:Kcnq1 UTSW 7 143363695 critical splice donor site probably null
R5732:Kcnq1 UTSW 7 143148756 intron probably benign
R5990:Kcnq1 UTSW 7 143261368 missense probably damaging 1.00
R6111:Kcnq1 UTSW 7 143107737 missense probably benign 0.00
R6534:Kcnq1 UTSW 7 143194327 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTCTACATAGCACCAACTCCCAT -3'
(R):5'- AGAGTGACACAGAAGGAGCTTT -3'

Sequencing Primer
(F):5'- TCATTCACAACCAAGGAAGTTGAG -3'
(R):5'- TGACACAGAAGGAGCTTTATGTCCC -3'
Posted On2017-06-26