Incidental Mutation 'R6160:Slc14a2'
ID489845
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6160 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 78158975 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434]
Predicted Effect probably null
Transcript: ENSMUST00000025434
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78159037 missense probably damaging 0.98
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATCTCCAAATCAGGGTAC -3'
(R):5'- CAGTTTCTTGACTGGGTGCTCC -3'

Sequencing Primer
(F):5'- GCCTGCAAGACAGTATTCTGCTAG -3'
(R):5'- TCCGGGGCATGTCTCAG -3'
Posted On2017-10-10