Incidental Mutation 'R6167:Glyctk'
ID490195
Institutional Source Beutler Lab
Gene Symbol Glyctk
Ensembl Gene ENSMUSG00000020258
Gene Nameglycerate kinase
Synonyms6230410P16Rik
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6167 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106152857-106158138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106156492 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 208 (T208S)
Ref Sequence ENSEMBL: ENSMUSP00000108162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036382] [ENSMUST00000112543] [ENSMUST00000159809] [ENSMUST00000162562] [ENSMUST00000217417]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036382
AA Change: T208S

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047761
Gene: ENSMUSG00000020258
AA Change: T208S

DomainStartEndE-ValueType
Pfam:DUF4147 36 291 1.9e-84 PFAM
low complexity region 363 383 N/A INTRINSIC
Pfam:MOFRL 401 514 3.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083473
Predicted Effect possibly damaging
Transcript: ENSMUST00000112543
AA Change: T208S

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108162
Gene: ENSMUSG00000020258
AA Change: T208S

DomainStartEndE-ValueType
Pfam:DUF4147 37 290 1.6e-86 PFAM
low complexity region 363 383 N/A INTRINSIC
Pfam:MOFRL 402 514 7.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150953
Predicted Effect probably benign
Transcript: ENSMUST00000159809
SMART Domains Protein: ENSMUSP00000125369
Gene: ENSMUSG00000020258

DomainStartEndE-ValueType
Pfam:DUF4147 36 92 8.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160569
Predicted Effect probably benign
Transcript: ENSMUST00000162562
SMART Domains Protein: ENSMUSP00000125392
Gene: ENSMUSG00000020258

DomainStartEndE-ValueType
Pfam:DUF4147 36 124 6.4e-17 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000217417
AA Change: H50L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the glycerate kinase type-2 family. The encoded enzyme catalyzes the phosphorylation of (R)-glycerate and may be involved in serine degradation and fructose metabolism. Decreased activity of the encoded enzyme may be associated with the disease D-glyceric aciduria. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Dcaf7 A T 11: 106,037,251 Y43F probably damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Fyb2 A G 4: 104,945,464 T188A possibly damaging Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Gtf2f1 G T 17: 57,004,161 S351R probably damaging Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Iars T A 13: 49,722,714 M825K probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Myo18b A T 5: 112,872,507 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Neurl1a G C 19: 47,239,928 G71A probably damaging Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Slc25a19 A G 11: 115,615,551 V272A probably benign Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Glyctk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Glyctk APN 9 106155272 missense probably damaging 1.00
IGL02307:Glyctk APN 9 106155764 missense possibly damaging 0.64
IGL02581:Glyctk APN 9 106157781 missense probably benign
R0106:Glyctk UTSW 9 106155969 missense probably benign 0.00
R1465:Glyctk UTSW 9 106157607 missense probably damaging 1.00
R1465:Glyctk UTSW 9 106157607 missense probably damaging 1.00
R1652:Glyctk UTSW 9 106157157 missense probably damaging 1.00
R1859:Glyctk UTSW 9 106157532 missense probably benign 0.08
R1870:Glyctk UTSW 9 106155348 missense probably damaging 1.00
R1962:Glyctk UTSW 9 106157865 start codon destroyed probably null 0.99
R3875:Glyctk UTSW 9 106157621 missense probably damaging 1.00
R4167:Glyctk UTSW 9 106157762 missense probably benign 0.01
R4407:Glyctk UTSW 9 106157108 intron probably benign
R5860:Glyctk UTSW 9 106155707 missense possibly damaging 0.54
R6240:Glyctk UTSW 9 106156262 intron probably null
R7253:Glyctk UTSW 9 106155462 missense probably damaging 1.00
X0004:Glyctk UTSW 9 106155719 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATCTTGCCACTTTCAGGTG -3'
(R):5'- ACCCCACCTTCTTAGAGGAC -3'

Sequencing Primer
(F):5'- TGGGCTGGCAGAACACCTAAC -3'
(R):5'- GGACCTTCCTTATGGCTTGC -3'
Posted On2017-10-10