Incidental Mutation 'R6167:Iars'
ID490214
Institutional Source Beutler Lab
Gene Symbol Iars
Ensembl Gene ENSMUSG00000037851
Gene Nameisoleucine-tRNA synthetase
SynonymsE430001P04Rik, 2510016L12Rik
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6167 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49682100-49734267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49722714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 825 (M825K)
Ref Sequence ENSEMBL: ENSMUSP00000132082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316]
Predicted Effect probably damaging
Transcript: ENSMUST00000047363
AA Change: M825K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851
AA Change: M825K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 9.2e-242 PFAM
Pfam:tRNA-synt_1g 46 197 3.7e-6 PFAM
Pfam:Anticodon_1 693 852 1.1e-23 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164260
AA Change: M825K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851
AA Change: M825K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165270
Predicted Effect probably damaging
Transcript: ENSMUST00000165316
AA Change: M825K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851
AA Change: M825K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165656
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Dcaf7 A T 11: 106,037,251 Y43F probably damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Fyb2 A G 4: 104,945,464 T188A possibly damaging Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Glyctk T A 9: 106,156,492 T208S possibly damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Gtf2f1 G T 17: 57,004,161 S351R probably damaging Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Myo18b A T 5: 112,872,507 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Neurl1a G C 19: 47,239,928 G71A probably damaging Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Slc25a19 A G 11: 115,615,551 V272A probably benign Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Iars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Iars APN 13 49709728 missense probably damaging 1.00
IGL00764:Iars APN 13 49711827 missense probably benign 0.34
IGL01153:Iars APN 13 49711805 missense probably damaging 1.00
IGL01481:Iars APN 13 49728698 missense probably benign 0.00
IGL01596:Iars APN 13 49703176 missense probably benign
IGL01682:Iars APN 13 49709658 missense probably damaging 1.00
IGL01885:Iars APN 13 49691499 missense probably benign 0.25
IGL01907:Iars APN 13 49709655 missense probably damaging 1.00
IGL02023:Iars APN 13 49688249 missense probably damaging 1.00
IGL02121:Iars APN 13 49724696 missense probably benign 0.00
IGL02365:Iars APN 13 49691499 missense probably benign 0.25
IGL02704:Iars APN 13 49721100 missense probably damaging 1.00
IGL02838:Iars APN 13 49690489 missense possibly damaging 0.87
IGL02975:Iars APN 13 49704849 missense probably damaging 1.00
IGL02982:Iars APN 13 49709709 missense probably benign 0.00
IGL03034:Iars APN 13 49690489 missense possibly damaging 0.87
IGL03060:Iars APN 13 49690447 critical splice acceptor site probably null
IGL03156:Iars APN 13 49703179 missense possibly damaging 0.87
IGL03206:Iars APN 13 49693070 missense possibly damaging 0.81
IGL03343:Iars APN 13 49724747 missense probably benign 0.12
gannett_peak UTSW 13 49708421 missense probably damaging 1.00
wind_river UTSW 13 49701895 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0184:Iars UTSW 13 49722212 missense probably benign 0.00
R0200:Iars UTSW 13 49726202 missense possibly damaging 0.62
R0356:Iars UTSW 13 49703233 missense probably benign 0.03
R0383:Iars UTSW 13 49732342 missense probably damaging 0.99
R0657:Iars UTSW 13 49702519 missense probably damaging 1.00
R1005:Iars UTSW 13 49687445 missense possibly damaging 0.94
R1427:Iars UTSW 13 49704269 critical splice acceptor site probably null
R1449:Iars UTSW 13 49733710 missense probably damaging 0.99
R1647:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1648:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1664:Iars UTSW 13 49711775 missense probably damaging 0.98
R1763:Iars UTSW 13 49723077 critical splice donor site probably null
R2192:Iars UTSW 13 49688129 intron probably null
R2203:Iars UTSW 13 49722675 missense probably benign 0.00
R2357:Iars UTSW 13 49688203 missense probably damaging 1.00
R3724:Iars UTSW 13 49687384 critical splice acceptor site probably null
R4785:Iars UTSW 13 49724663 missense probably damaging 0.99
R4934:Iars UTSW 13 49717984 missense probably benign 0.17
R4999:Iars UTSW 13 49709661 missense probably damaging 1.00
R5048:Iars UTSW 13 49688237 missense probably damaging 0.99
R5268:Iars UTSW 13 49690491 missense probably damaging 1.00
R5394:Iars UTSW 13 49722165 missense probably damaging 1.00
R5486:Iars UTSW 13 49709573 splice site probably null
R5960:Iars UTSW 13 49724637 missense possibly damaging 0.68
R5972:Iars UTSW 13 49709632 missense possibly damaging 0.91
R5978:Iars UTSW 13 49722993 missense probably damaging 0.99
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6092:Iars UTSW 13 49708421 missense probably damaging 1.00
R6313:Iars UTSW 13 49708445 missense probably damaging 0.99
R6358:Iars UTSW 13 49727143 missense possibly damaging 0.67
R6385:Iars UTSW 13 49701895 missense probably damaging 1.00
R6403:Iars UTSW 13 49687495 missense probably damaging 1.00
R6575:Iars UTSW 13 49725269 missense probably damaging 1.00
R6675:Iars UTSW 13 49719578 missense probably damaging 0.99
R6957:Iars UTSW 13 49722161 missense probably damaging 1.00
Z1088:Iars UTSW 13 49721088 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTGGGTGACATCTTTTC -3'
(R):5'- TGTTGAACGCTCATCTGTCTGG -3'

Sequencing Primer
(F):5'- CTCAGTTATCGCTGGAGACCTAG -3'
(R):5'- TAAGCTAGCTCCAGGCCATTC -3'
Posted On2017-10-10