Incidental Mutation 'R0535:Itga2b'
ID49425
Institutional Source Beutler Lab
Gene Symbol Itga2b
Ensembl Gene ENSMUSG00000034664
Gene Nameintegrin alpha 2b
Synonymsplatelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41
MMRRC Submission 038727-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R0535 (G1)
Quality Score175
Status Validated
Chromosome11
Chromosomal Location102453297-102470122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102457533 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 791 (V791A)
Ref Sequence ENSEMBL: ENSMUSP00000099375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103086
AA Change: V791A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: V791A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174900
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Itga2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Itga2b APN 11 102455583 missense probably damaging 1.00
IGL02197:Itga2b APN 11 102466319 missense probably benign 0.19
IGL02349:Itga2b APN 11 102461363 missense probably damaging 0.98
IGL02711:Itga2b APN 11 102465725 missense possibly damaging 0.53
R0282:Itga2b UTSW 11 102460846 missense probably damaging 0.99
R0349:Itga2b UTSW 11 102467426 missense probably damaging 0.98
R0384:Itga2b UTSW 11 102465362 splice site probably null
R0403:Itga2b UTSW 11 102467326 critical splice donor site probably null
R0452:Itga2b UTSW 11 102465953 intron probably null
R1412:Itga2b UTSW 11 102457005 missense probably benign 0.00
R1517:Itga2b UTSW 11 102466325 nonsense probably null
R1615:Itga2b UTSW 11 102460137 critical splice donor site probably null
R1716:Itga2b UTSW 11 102460777 missense probably benign 0.30
R1953:Itga2b UTSW 11 102458183 missense probably benign 0.18
R2001:Itga2b UTSW 11 102467339 missense probably benign
R2216:Itga2b UTSW 11 102467866 missense probably benign 0.35
R4193:Itga2b UTSW 11 102469685 missense probably benign 0.01
R4770:Itga2b UTSW 11 102460756 missense probably damaging 1.00
R4805:Itga2b UTSW 11 102467866 missense probably benign 0.00
R4880:Itga2b UTSW 11 102457722 intron probably benign
R4906:Itga2b UTSW 11 102461159 missense probably benign 0.43
R5112:Itga2b UTSW 11 102458191 missense probably damaging 0.99
R5362:Itga2b UTSW 11 102461135 missense probably damaging 0.99
R5739:Itga2b UTSW 11 102465909 missense probably benign 0.14
R5761:Itga2b UTSW 11 102466274 missense probably benign 0.00
R5840:Itga2b UTSW 11 102461331 missense probably damaging 1.00
R5851:Itga2b UTSW 11 102457601 intron probably benign
R6239:Itga2b UTSW 11 102465318 missense possibly damaging 0.61
R6491:Itga2b UTSW 11 102459869 splice site probably null
R7426:Itga2b UTSW 11 102456294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCACAGTGCCAGGGCCAATG -3'
(R):5'- ATCCAAGCTGAAGCCACAGTGGAG -3'

Sequencing Primer
(F):5'- ATAGCGGGGTGGCTCAG -3'
(R):5'- gaggtgggcgtgtagttc -3'
Posted On2013-06-12