Incidental Mutation 'R1467:Rap1gap2'
ID500250
Institutional Source Beutler Lab
Gene Symbol Rap1gap2
Ensembl Gene ENSMUSG00000038807
Gene NameRAP1 GTPase activating protein 2
SynonymsGarnl4, LOC380710
MMRRC Submission 039520-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R1467 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74383356-74610915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74437027 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 139 (V139A)
Ref Sequence ENSEMBL: ENSMUSP00000146728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047488] [ENSMUST00000102521] [ENSMUST00000145524] [ENSMUST00000208896]
Predicted Effect probably benign
Transcript: ENSMUST00000047488
AA Change: V171A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040180
Gene: ENSMUSG00000038807
AA Change: V171A

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 445 1.2e-64 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102521
AA Change: V111A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099580
Gene: ENSMUSG00000038807
AA Change: V111A

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 439 4.9e-67 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145524
Predicted Effect possibly damaging
Transcript: ENSMUST00000208896
AA Change: V139A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.1%
  • 10x: 88.5%
  • 20x: 62.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,463 V9L possibly damaging Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Btg3 A G 16: 78,364,800 probably null Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Ces4a T A 8: 105,138,035 V48E possibly damaging Het
Cfap54 T A 10: 92,969,763 H1495L probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gabpb1 T G 2: 126,652,327 Y126S probably damaging Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Hoxb9 A G 11: 96,271,938 T133A probably benign Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Mtcl1 T C 17: 66,448,327 D340G probably damaging Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd1l3 C T 8: 109,616,368 P113S unknown Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Setx T A 2: 29,158,905 V1981E probably damaging Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Rap1gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Rap1gap2 APN 11 74416259 missense probably benign 0.25
IGL00839:Rap1gap2 APN 11 74437448 missense probably damaging 1.00
IGL02301:Rap1gap2 APN 11 74407369 missense probably damaging 1.00
IGL02367:Rap1gap2 APN 11 74397355 critical splice donor site probably null
IGL02832:Rap1gap2 APN 11 74412455 splice site probably benign
IGL03067:Rap1gap2 APN 11 74393412 missense possibly damaging 0.63
IGL03341:Rap1gap2 APN 11 74435714 missense probably damaging 1.00
IGL03355:Rap1gap2 APN 11 74412344 missense probably damaging 1.00
P0026:Rap1gap2 UTSW 11 74567210 splice site probably benign
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0514:Rap1gap2 UTSW 11 74388854 missense possibly damaging 0.74
R0518:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R0521:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R1070:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1998:Rap1gap2 UTSW 11 74395833 missense probably benign 0.04
R2144:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2145:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2180:Rap1gap2 UTSW 11 74393146 missense probably benign 0.24
R2938:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2991:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2992:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2993:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3033:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3035:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3686:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4426:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4427:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4621:Rap1gap2 UTSW 11 74435699 critical splice donor site probably null
R4705:Rap1gap2 UTSW 11 74437439 missense probably damaging 1.00
R4809:Rap1gap2 UTSW 11 74407974 splice site probably benign
R5092:Rap1gap2 UTSW 11 74438295 missense probably damaging 1.00
R5283:Rap1gap2 UTSW 11 74395825 missense probably damaging 1.00
R5343:Rap1gap2 UTSW 11 74441785 missense probably damaging 0.99
R5941:Rap1gap2 UTSW 11 74392237 missense probably damaging 1.00
R6414:Rap1gap2 UTSW 11 74405790 missense probably damaging 1.00
R6647:Rap1gap2 UTSW 11 74407928 missense probably benign 0.04
R6951:Rap1gap2 UTSW 11 74484948 missense possibly damaging 0.81
R7096:Rap1gap2 UTSW 11 74392231 missense probably damaging 0.99
R7107:Rap1gap2 UTSW 11 74393119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCTGGAACAGAGATCCATGTC -3'
(R):5'- GTGAAGCTAGAGATGCCCTTGACC -3'

Sequencing Primer
(F):5'- AGAGATCCATGTCCCCCTC -3'
(R):5'- GATGCCCTTGACCTGAGATAG -3'
Posted On2017-12-01