Incidental Mutation 'R1467:Setx'
ID164539
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 039520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1467 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29158905 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1981 (V1981E)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably damaging
Transcript: ENSMUST00000061578
AA Change: V1981E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: V1981E

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135992
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.1%
  • 10x: 88.5%
  • 20x: 62.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,463 V9L possibly damaging Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Btg3 A G 16: 78,364,800 probably null Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Ces4a T A 8: 105,138,035 V48E possibly damaging Het
Cfap54 T A 10: 92,969,763 H1495L probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gabpb1 T G 2: 126,652,327 Y126S probably damaging Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Hoxb9 A G 11: 96,271,938 T133A probably benign Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Mtcl1 T C 17: 66,448,327 D340G probably damaging Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd1l3 C T 8: 109,616,368 P113S unknown Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7556:Setx UTSW 2 29146493 missense possibly damaging 0.88
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGAACTGCGTGCCACAGTTAC -3'
(R):5'- GGAAGGCACCACTTCAGAAGGAATC -3'

Sequencing Primer
(F):5'- GCGTGCCACAGTTACTTATATTG -3'
(R):5'- GATCAGCTCCTAAGCTTTGGAAC -3'
Posted On2014-03-28