Incidental Mutation 'R6260:Lgr6'
ID506596
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 6
SynonymsA530037C04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6260 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134983301-135105276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134994010 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000122334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]
Predicted Effect probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

DomainStartEndE-ValueType
Blast:LRR 4 26 2e-7 BLAST
LRR 50 73 9.24e1 SMART
LRR 74 96 1.41e0 SMART
LRR 97 119 4.84e1 SMART
LRR_TYP 120 143 4.54e-4 SMART
LRR_TYP 144 167 7.15e-2 SMART
Pfam:7tm_1 301 550 3.6e-9 PFAM
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,008,987 N1514K probably damaging Het
Abcb4 G T 5: 8,934,219 G650* probably null Het
Acsbg1 T A 9: 54,628,467 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
Ank2 C T 3: 126,943,557 V2806I probably benign Het
Atxn10 A T 15: 85,462,411 I457F probably benign Het
Cad G T 5: 31,066,800 M800I probably null Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Ccz1 A G 5: 144,004,041 probably null Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Cfap52 A T 11: 67,938,954 C330S possibly damaging Het
Clec16a C T 16: 10,694,848 probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddhd2 A G 8: 25,752,117 F244L probably benign Het
Ddn A G 15: 98,805,854 V519A possibly damaging Het
Dip2b G T 15: 100,162,702 V253L probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Foxd4 A G 19: 24,899,604 S411P probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Galntl6 T A 8: 57,884,481 D135V probably damaging Het
Gm1043 G C 5: 37,174,472 G832A probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm21103 C T 14: 6,303,847 E68K probably damaging Het
Gm340 A T 19: 41,582,370 S1C probably null Het
Gm340 G T 19: 41,582,371 S1I possibly damaging Het
Gpam A G 19: 55,083,406 V301A probably benign Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jak3 C A 8: 71,679,310 Q177K probably benign Het
Kcnu1 G A 8: 25,851,891 R88H probably damaging Het
Kng1 A T 16: 23,058,621 I60F possibly damaging Het
Krt77 A T 15: 101,864,372 Y257* probably null Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mefv C T 16: 3,713,034 R498H probably benign Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Mtcl1 T A 17: 66,343,541 Q1340L probably damaging Het
Nfic A T 10: 81,420,517 C126* probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr694 A T 7: 106,688,872 N286K probably damaging Het
Olfr808 C A 10: 129,767,520 T8K probably benign Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Plxnb2 A T 15: 89,165,291 I575N probably benign Het
Pnmal2 T G 7: 16,946,233 W381G probably benign Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rwdd2b C A 16: 87,434,468 G266V probably damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
St8sia2 T A 7: 73,976,693 R42S possibly damaging Het
Syt9 G T 7: 107,436,510 V245F possibly damaging Het
Tbpl2 T A 2: 24,094,886 N82I possibly damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Timm13 A C 10: 80,900,301 probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ttc27 T A 17: 74,858,091 V764D probably damaging Het
Ttc39d C A 17: 80,216,647 S245* probably null Het
Ttc41 A G 10: 86,731,159 E563G probably benign Het
Ttc41 A T 10: 86,733,707 T650S probably benign Het
U2surp A C 9: 95,476,157 L723R probably damaging Het
Ubqln3 G A 7: 104,142,317 Q189* probably null Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Vmn2r79 T A 7: 87,037,157 M582K probably benign Het
Zfp518a A G 19: 40,914,123 D832G probably benign Het
Zfyve28 T C 5: 34,198,872 N762D probably damaging Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R2020:Lgr6 UTSW 1 135075275 missense probably damaging 1.00
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R4792:Lgr6 UTSW 1 135021806 missense probably benign 0.03
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5197:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5230:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5300:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5748:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAGTAGGCCACTTCCTTCG -3'
(R):5'- CAGGAATCAGGCTTCAAGATTCC -3'

Sequencing Primer
(F):5'- TTCCTTCGGGGTCACAAGGATC -3'
(R):5'- TTATGGTTGCAAGTCACCACAGC -3'
Posted On2018-03-15