Incidental Mutation 'R6328:Lmna'
ID510796
Institutional Source Beutler Lab
Gene Symbol Lmna
Ensembl Gene ENSMUSG00000028063
Gene Namelamin A
SynonymsDhe, lamin A/C
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88480147-88509956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88486506 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 255 (Q255R)
Ref Sequence ENSEMBL: ENSMUSP00000113093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029699] [ENSMUST00000036252] [ENSMUST00000120377]
Predicted Effect probably damaging
Transcript: ENSMUST00000029699
AA Change: Q255R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029699
Gene: ENSMUSG00000028063
AA Change: Q255R

DomainStartEndE-ValueType
Filament 30 386 4.38e-45 SMART
low complexity region 395 414 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
Pfam:LTD 433 544 4e-15 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 600 639 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000036252
AA Change: Q143R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040265
Gene: ENSMUSG00000028063
AA Change: Q143R

DomainStartEndE-ValueType
Pfam:Filament 2 274 5.6e-66 PFAM
low complexity region 283 302 N/A INTRINSIC
Pfam:LTD 317 436 1.2e-22 PFAM
low complexity region 439 450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120377
AA Change: Q255R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113093
Gene: ENSMUSG00000028063
AA Change: Q255R

DomainStartEndE-ValueType
Pfam:Filament 30 386 1.3e-95 PFAM
low complexity region 395 414 N/A INTRINSIC
Pfam:LTD 429 548 1.7e-22 PFAM
low complexity region 551 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150496
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the lamin family. Nuclear lamins, intermediate filament-like proteins, are the major components of the nuclear lamina, a protein meshwork associated with the inner nuclear membrane. This meshwork is thought to maintain the integrity of the nuclear envelope, participate in chromatin organization, and regulate gene transcription. Vertebrate lamins consist of two types, A and B. This protein is an A-type and is proposed to be developmentally regulated. In mouse deficiency of this gene is associated with muscular dystrophy. Mouse lines with different mutations in this gene serve as pathophysiological models for several human laminopathies. In humans, mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit retarded postnatal growth, muscular dystrophy, reduced fat stores, micrognathy, abnormal dentition, impaired gonadal development, malformed scapulae, hyperkeratosis, and die by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Lmna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lmna APN 3 88484684 missense probably benign 0.05
IGL00933:Lmna APN 3 88482549 missense possibly damaging 0.73
IGL01347:Lmna APN 3 88484963 missense probably benign 0.42
IGL02881:Lmna APN 3 88502926 missense possibly damaging 0.56
P0029:Lmna UTSW 3 88483917 missense possibly damaging 0.88
R0606:Lmna UTSW 3 88482578 missense probably damaging 1.00
R1547:Lmna UTSW 3 88482351 missense probably benign 0.00
R4751:Lmna UTSW 3 88486533 missense possibly damaging 0.87
R5157:Lmna UTSW 3 88484107 missense probably damaging 1.00
R5857:Lmna UTSW 3 88482531 unclassified probably benign
R6112:Lmna UTSW 3 88486621 nonsense probably null
R6263:Lmna UTSW 3 88502958 missense probably damaging 1.00
R6604:Lmna UTSW 3 88488282 missense probably damaging 0.97
R7100:Lmna UTSW 3 88484990 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGTTGCTGTTCCTCTCAG -3'
(R):5'- GCTTCTAAGGAACCATTGCG -3'

Sequencing Primer
(F):5'- AGCAGACTGCCTGGCATTATC -3'
(R):5'- GCTTCTAAGGAACCATTGCGATGTTC -3'
Posted On2018-04-02