Incidental Mutation 'R6328:Sntg2'
ID510822
Institutional Source Beutler Lab
Gene Symbol Sntg2
Ensembl Gene ENSMUSG00000020672
Gene Namesyntrophin, gamma 2
Synonyms2210008K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location30174482-30373375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30258014 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 224 (L224R)
Ref Sequence ENSEMBL: ENSMUSP00000021004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021004] [ENSMUST00000133324] [ENSMUST00000142046] [ENSMUST00000149710]
Predicted Effect probably damaging
Transcript: ENSMUST00000021004
AA Change: L224R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021004
Gene: ENSMUSG00000020672
AA Change: L224R

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
PH 297 423 7.66e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133324
SMART Domains Protein: ENSMUSP00000114245
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 70 9e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142046
SMART Domains Protein: ENSMUSP00000115942
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 89 1e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149710
SMART Domains Protein: ENSMUSP00000123332
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that bind to components of mechanosenstive sodium channels and the extreme carboxy-terminal domain of dystrophin and dystrophin-related proteins. The PDZ domain of this protein product interacts with a protein component of a mechanosensitive sodium channel that affects channel gating. Absence or reduction of this protein product has been associated with Duchenne muscular dystrophy. There is evidence of alternative splicing yet the full-length nature of these variants has not been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Sntg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sntg2 APN 12 30276721 missense probably benign 0.08
IGL00914:Sntg2 APN 12 30257957 intron probably benign
IGL00950:Sntg2 APN 12 30312681 splice site probably benign
IGL01106:Sntg2 APN 12 30257988 nonsense probably null
IGL01732:Sntg2 APN 12 30312649 missense probably damaging 0.99
IGL01987:Sntg2 APN 12 30312570 missense probably damaging 1.00
IGL02138:Sntg2 APN 12 30307231 critical splice acceptor site probably null
IGL02325:Sntg2 APN 12 30195543 missense probably benign 0.08
IGL02619:Sntg2 APN 12 30267026 splice site probably null
IGL02797:Sntg2 APN 12 30226892 missense possibly damaging 0.93
IGL03176:Sntg2 APN 12 30267023 splice site probably benign
PIT4445001:Sntg2 UTSW 12 30312572 missense probably damaging 1.00
R0126:Sntg2 UTSW 12 30201261 splice site probably benign
R0309:Sntg2 UTSW 12 30226773 missense probably benign 0.03
R0614:Sntg2 UTSW 12 30257978 missense possibly damaging 0.87
R1267:Sntg2 UTSW 12 30245128 missense probably benign 0.42
R1546:Sntg2 UTSW 12 30288296 missense probably damaging 1.00
R1696:Sntg2 UTSW 12 30267063 missense probably damaging 1.00
R1708:Sntg2 UTSW 12 30373180 missense possibly damaging 0.81
R1867:Sntg2 UTSW 12 30236651 missense probably benign
R2256:Sntg2 UTSW 12 30236688 nonsense probably null
R2895:Sntg2 UTSW 12 30226846 missense probably benign 0.00
R3401:Sntg2 UTSW 12 30288172 splice site probably benign
R3522:Sntg2 UTSW 12 30312567 missense probably damaging 0.99
R4771:Sntg2 UTSW 12 30276659 splice site probably null
R4814:Sntg2 UTSW 12 30373268 unclassified probably benign
R5554:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R6056:Sntg2 UTSW 12 30312561 missense probably benign 0.06
R6373:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R7314:Sntg2 UTSW 12 30267108 missense probably benign 0.01
R7494:Sntg2 UTSW 12 30229634 missense possibly damaging 0.89
R7571:Sntg2 UTSW 12 30175202 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCGGCACTTCCTCAAATGC -3'
(R):5'- TTTCATCAGTGGAAGTGGGC -3'

Sequencing Primer
(F):5'- GAGACAATGCCTATGCCTGC -3'
(R):5'- TCAGTGGAAGTGGGCTGAGC -3'
Posted On2018-04-02