Incidental Mutation 'R6330:Myo5b'
ID510881
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74616993 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 176 (A176T)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875] [ENSMUST00000125882]
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: A176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: A176T

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120161
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: A176T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: A176T

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125882
AA Change: A174T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123123
Gene: ENSMUSG00000025885
AA Change: A174T

DomainStartEndE-ValueType
MYSc 61 183 8.63e-4 SMART
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACATTTATTCCCCAAGAGATGCTTC -3'
(R):5'- ACCCTGGGTTTCAGAGGTAC -3'

Sequencing Primer
(F):5'- GAGATGCTTCTCACCAGGTTAC -3'
(R):5'- TGGGTTTCAGAGGTACCTCCAC -3'
Posted On2018-04-02