Incidental Mutation 'R5043:Myo5b'
ID393321
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 74638153 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875] [ENSMUST00000121875]
Predicted Effect probably null
Transcript: ENSMUST00000074157
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120161
Predicted Effect probably null
Transcript: ENSMUST00000121875
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121875
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125751
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
R6985_Myo5b_942 UTSW 18 74653361 missense possibly damaging 0.93
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGGAGTCATTAACCCTAACCCAGG -3'
(R):5'- ACTTGAAGGCAGCCGATTTG -3'

Sequencing Primer
(F):5'- GGGTAAAAAGTCCTTTCTATCGTAGC -3'
(R):5'- GCAGCCGATTTGAAATGAATTGGTTC -3'
Posted On2016-06-15