Incidental Mutation 'FR4449:Pih1d2'
ID511498
Institutional Source Beutler Lab
Gene Symbol Pih1d2
Ensembl Gene ENSMUSG00000000167
Gene NamePIH1 domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #FR4449 ()
Quality Score214.458
Status Not validated
Chromosome9
Chromosomal Location50617321-50625000 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTCTTGCGAGGATC to CTC at 50621627 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000171] [ENSMUST00000125606] [ENSMUST00000131351] [ENSMUST00000132187] [ENSMUST00000141366] [ENSMUST00000145139] [ENSMUST00000147671] [ENSMUST00000151197] [ENSMUST00000155435] [ENSMUST00000171462]
Predicted Effect probably null
Transcript: ENSMUST00000000171
SMART Domains Protein: ENSMUSP00000000171
Gene: ENSMUSG00000000167

DomainStartEndE-ValueType
Pfam:PIH1 19 314 4.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124029
Predicted Effect probably benign
Transcript: ENSMUST00000125606
SMART Domains Protein: ENSMUSP00000121100
Gene: ENSMUSG00000000167

DomainStartEndE-ValueType
Pfam:PIH1 19 140 2.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131351
SMART Domains Protein: ENSMUSP00000123319
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132187
SMART Domains Protein: ENSMUSP00000118064
Gene: ENSMUSG00000000167

DomainStartEndE-ValueType
Pfam:PIH1 19 92 1.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141366
SMART Domains Protein: ENSMUSP00000122789
Gene: ENSMUSG00000000167

DomainStartEndE-ValueType
Pfam:PIH1 35 198 2.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145139
Predicted Effect probably benign
Transcript: ENSMUST00000147671
SMART Domains Protein: ENSMUSP00000117265
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151197
SMART Domains Protein: ENSMUSP00000119253
Gene: ENSMUSG00000000167

DomainStartEndE-ValueType
Pfam:PIH1 19 235 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155435
SMART Domains Protein: ENSMUSP00000121198
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
low complexity region 198 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155773
Predicted Effect probably benign
Transcript: ENSMUST00000171462
SMART Domains Protein: ENSMUSP00000133259
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
Pfam:NKAP 86 163 5.2e-26 PFAM
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4932415D10Rik TTCAGT TT 10: 82,285,469 probably null Homo
Akap9 GGTATTGCATTTCTTATCT G 5: 3,981,214 probably benign Homo
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,282,000 probably benign Het
Apc AGC AGCCAATAACGC 18: 34,282,005 probably benign Het
Apol6 TTT TTTGATT 15: 77,051,443 probably null Homo
Arid1b CGG CGGTGG 17: 4,995,589 probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,386,851 probably benign Homo
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,908 probably benign Het
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,116,336 probably benign Het
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Homo
Cacna1a ACC ACCCCC 8: 84,638,714 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,141,274 probably benign Het
Ccdc15 C CTTTAT 9: 37,315,158 probably null Het
Ccdc85c CCG CCGACG 12: 108,274,616 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,725,924 probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,257,823 probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,019,881 probably benign Het
Cfap46 T C 7: 139,638,795 probably benign Homo
Cgref1 TTC TTCGTC 5: 30,933,776 probably benign Het
Cgref1 CTT CTTATT 5: 30,933,778 probably null Homo
Cluh G GACTGAA 11: 74,669,532 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cpne1 CCTACT CCT 2: 156,073,502 probably benign Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,462 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,856 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,674 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,738,184 probably benign Homo
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Dhx8 CG CGAGACAG 11: 101,738,194 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,206 probably benign Het
Dhx8 G GAGACCC 11: 101,738,207 probably benign Het
Dspp CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG 5: 104,178,388 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,763,513 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,074 probably benign Het
Fgd6 GGAT G 10: 94,044,320 probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,577,180 probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,830,704 probably benign Homo
Gatad2b AGAC A 3: 90,341,917 probably benign Het
Gigyf2 C T 1: 87,428,585 probably benign Het
Gm16519 A AGAT 17: 70,929,338 probably benign Homo
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,085 probably benign Het
Gm4340 GCA GCATCA 10: 104,196,086 probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 78,842,168 probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,176 probably benign Het
Gpatch11 GG GGCAGACG 17: 78,842,181 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,835,280 probably benign Homo
Igsf10 G A 3: 59,319,110 R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 27,082,678 probably benign Het
Ints5 G A 19: 8,897,230 R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,931,713 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kifc5b A C 17: 26,924,217 E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,221,846 probably null Homo
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Krt10 ACC ACCACCTCC 11: 99,389,267 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 93,018,152 probably benign Het
Leo1 GTACCATGCA G 9: 75,450,573 probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,697,571 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Homo
Med12l CAG CAGTAG 3: 59,275,963 probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,540,997 probably benign Homo
Mn1 GCA GCAACA 5: 111,419,710 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,076,109 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Noc2l C CTGA 4: 156,240,101 probably benign Het
Nrg3 T TAGACAC 14: 38,397,271 probably benign Het
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 G GGAA 19: 41,281,946 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Qrich2 AACT A 11: 116,456,199 probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,370,915 probably benign Het
Rbm33 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA 5: 28,394,168 probably benign Homo
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,967,456 probably null Het
Sbp CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA 17: 23,945,364 probably benign Het
Setd1a G A 7: 127,785,326 probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,569,748 probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,569,749 probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,423,065 probably benign Homo
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 125,154,216 probably benign Homo
Slc26a8 CTCTCTG C 17: 28,638,316 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Sry TGCTG TGCTGCTG Y: 2,662,832 probably benign Homo
Ston1 G A 17: 88,635,525 V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,649 probably benign Het
Tbl3 TG TGTGG 17: 24,702,544 probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,607,202 probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 probably benign Homo
Tmc2 T G 2: 130,240,196 V433G probably damaging Het
Tmprss13 G A 9: 45,328,558 A55T unknown Het
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tob1 CAG CAGAAG 11: 94,214,468 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,475 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Homo
Triobp GTC GTCTTC 15: 78,993,389 probably benign Het
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Xpnpep3 G C 15: 81,427,422 D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,323,601 probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 108,956,094 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 CTC CTCATC 2: 164,907,477 probably benign Het
Zfp335 CTCT CTCTTCT 2: 164,907,483 probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,785 probably benign Het
Zfp831 TCC TCCACC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCGTC 2: 174,645,482 probably benign Het
Zfp978 G T 4: 147,390,944 S316I probably benign Het
Other mutations in Pih1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Pih1d2 APN 9 50621877 missense probably benign 0.09
R0390:Pih1d2 UTSW 9 50621046 missense probably damaging 1.00
R0443:Pih1d2 UTSW 9 50621103 missense possibly damaging 0.46
R1570:Pih1d2 UTSW 9 50621179 missense probably benign 0.06
R1874:Pih1d2 UTSW 9 50620945 missense possibly damaging 0.68
R2207:Pih1d2 UTSW 9 50621079 missense probably benign 0.17
R4667:Pih1d2 UTSW 9 50620952 nonsense probably null
R5806:Pih1d2 UTSW 9 50618450 unclassified probably benign
R5811:Pih1d2 UTSW 9 50621074 missense probably damaging 1.00
R5949:Pih1d2 UTSW 9 50624984 missense probably damaging 1.00
R6156:Pih1d2 UTSW 9 50621152 missense possibly damaging 0.88
R6416:Pih1d2 UTSW 9 50618609 missense probably benign 0.00
R6711:Pih1d2 UTSW 9 50618010 start codon destroyed probably null
R7052:Pih1d2 UTSW 9 50621777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCAGAGTCAAATCCAAC -3'
(R):5'- TTCAGAGGTTTCTCGTTCCG -3'

Sequencing Primer
(F):5'- TCAGATGCTAGGCAGGCGATC -3'
(R):5'- AGAGGTTTCTCGTTCCGATCCTTTAC -3'
Posted On2018-04-05