Incidental Mutation 'R6501:Pbx1'
ID519710
Institutional Source Beutler Lab
Gene Symbol Pbx1
Ensembl Gene ENSMUSG00000052534
Gene Namepre B cell leukemia homeobox 1
SynonymsPbx1b, Pbx1a, D230003C07Rik, Pbx-1, 2310056B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location168119364-168432270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 168209534 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 109 (D109E)
Ref Sequence ENSEMBL: ENSMUSP00000140606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064438] [ENSMUST00000072863] [ENSMUST00000176540] [ENSMUST00000176790] [ENSMUST00000188912]
Predicted Effect probably damaging
Transcript: ENSMUST00000064438
AA Change: D109E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066385
Gene: ENSMUSG00000052534
AA Change: D109E

DomainStartEndE-ValueType
Pfam:PBC 35 232 2e-106 PFAM
HOX 233 290 5.15e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000072863
AA Change: D109E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072640
Gene: ENSMUSG00000052534
AA Change: D109E

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176482
Predicted Effect probably damaging
Transcript: ENSMUST00000176540
AA Change: D109E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135516
Gene: ENSMUSG00000052534
AA Change: D109E

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:PBC 40 232 6.9e-98 PFAM
HOX 233 298 6.17e-18 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176790
AA Change: D109E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134925
Gene: ENSMUSG00000052534
AA Change: D109E

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188912
AA Change: D109E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140606
Gene: ENSMUSG00000052534
AA Change: D109E

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a homeobox protein that belongs to the three-amino-acid loop extension/Pre-B cell leukemia transcription factor (TALE/PBX) family of proteins. The encoded protein is involved in several biological processes during embryogenesis including steroidogenesis, sexual development and the maintenance of hematopoietic stem cells. This protein functions in the development of several organ systems and plays a role in skeletal patterning and programming. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous disruption of this gene causes late gestational death, hypoplasia/aplasia of many organs, impaired hematopoiesis, anemia, skin edema, axial and appendicular skeleton defects, absent adrenal glands, abnormal chondrocyte differentiation, and abnormal bone, kidney and pancreas development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Pbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Pbx1 APN 1 168191304 missense probably benign 0.00
IGL02256:Pbx1 APN 1 168183602 missense possibly damaging 0.88
IGL03040:Pbx1 APN 1 168427946 splice site probably benign
root_cause UTSW 1 168209534 missense probably damaging 1.00
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0947:Pbx1 UTSW 1 168203366 missense probably damaging 1.00
R1785:Pbx1 UTSW 1 168431378 missense probably benign 0.09
R1893:Pbx1 UTSW 1 168203410 missense possibly damaging 0.91
R3552:Pbx1 UTSW 1 168158793 missense possibly damaging 0.88
R4176:Pbx1 UTSW 1 168191272 splice site probably null
R4757:Pbx1 UTSW 1 168195881 missense probably damaging 1.00
R5024:Pbx1 UTSW 1 168183589 missense possibly damaging 0.93
R6102:Pbx1 UTSW 1 168183565 missense probably benign 0.05
R6296:Pbx1 UTSW 1 168183615 missense possibly damaging 0.71
R6302:Pbx1 UTSW 1 168191341 missense probably benign
R6488:Pbx1 UTSW 1 168191395 missense probably damaging 1.00
R7014:Pbx1 UTSW 1 168431380 missense probably damaging 0.98
R7070:Pbx1 UTSW 1 168195768 missense probably damaging 0.98
X0024:Pbx1 UTSW 1 168431365 nonsense probably null
X0027:Pbx1 UTSW 1 168183612 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACCATGATGCCCAGTCTGTAG -3'
(R):5'- GACACTTGATCTGGAAGCTGG -3'

Sequencing Primer
(F):5'- GGTGAGGTTACCTGCTCATAC -3'
(R):5'- CTGGCTTGATTGAGAGACGCAG -3'
Posted On2018-06-06