Incidental Mutation 'R6523:Coasy'
ID521526
Institutional Source Beutler Lab
Gene Symbol Coasy
Ensembl Gene ENSMUSG00000001755
Gene NameCoenzyme A synthase
SynonymsPpat, 1300003G02Rik, Ukr1, Dpck
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R6523 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101082565-101086619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101086118 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 535 (W535R)
Ref Sequence ENSEMBL: ENSMUSP00000102929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001806] [ENSMUST00000017945] [ENSMUST00000107302] [ENSMUST00000107303] [ENSMUST00000107308] [ENSMUST00000149597]
Predicted Effect probably damaging
Transcript: ENSMUST00000001806
AA Change: W535R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001806
Gene: ENSMUSG00000001755
AA Change: W535R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_2 194 338 1.4e-11 PFAM
Pfam:CoaE 358 536 5.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017945
SMART Domains Protein: ENSMUSP00000017945
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
HLH 135 193 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107302
SMART Domains Protein: ENSMUSP00000102923
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
HLH 81 139 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107303
SMART Domains Protein: ENSMUSP00000102924
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
HLH 51 109 8.13e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107308
AA Change: W535R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102929
Gene: ENSMUSG00000001755
AA Change: W535R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_like 194 338 5.3e-11 PFAM
Pfam:CoaE 358 536 1.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149411
Predicted Effect probably benign
Transcript: ENSMUST00000149597
SMART Domains Protein: ENSMUSP00000121600
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:HLH 100 127 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151686
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes the bifunctional protein coenzyme A (CoA) synthase which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this protein catalyzes the conversion of phosphopantetheine into dephospho-CoA while its dephospho-CoA kinase domain completes the final step by phosphorylating dephospho-CoA to form CoA. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Coasy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Coasy APN 11 101084358 missense possibly damaging 0.76
IGL02633:Coasy APN 11 101085321 missense probably damaging 1.00
R0946:Coasy UTSW 11 101085870 missense probably damaging 0.96
R1434:Coasy UTSW 11 101084996 unclassified probably benign
R2269:Coasy UTSW 11 101085882 missense probably benign 0.01
R2881:Coasy UTSW 11 101085849 missense possibly damaging 0.90
R5037:Coasy UTSW 11 101084822 missense probably damaging 1.00
R5791:Coasy UTSW 11 101084385 unclassified probably null
R6696:Coasy UTSW 11 101083101 missense possibly damaging 0.68
R6931:Coasy UTSW 11 101083581 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCTGCTCTGATCCAGTAGACTG -3'
(R):5'- TTGGCGCCATAGAAAATCCAC -3'

Sequencing Primer
(F):5'- AGTAGACTGGGCTAGGACCCTTC -3'
(R):5'- GAAAATCCACTGTCAGTTCCTGG -3'
Posted On2018-06-06