Incidental Mutation 'R6641:1700022I11Rik'
ID525786
Institutional Source Beutler Lab
Gene Symbol 1700022I11Rik
Ensembl Gene ENSMUSG00000028451
Gene NameRIKEN cDNA 1700022I11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6641 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location42969604-42983640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42971245 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 193 (I193V)
Ref Sequence ENSEMBL: ENSMUSP00000030163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030163] [ENSMUST00000139127] [ENSMUST00000185904] [ENSMUST00000190902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030163
AA Change: I193V

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030163
Gene: ENSMUSG00000028451
AA Change: I193V

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
internal_repeat_1 322 432 6.53e-5 PROSPERO
low complexity region 434 449 N/A INTRINSIC
low complexity region 507 521 N/A INTRINSIC
low complexity region 599 610 N/A INTRINSIC
internal_repeat_1 622 738 6.53e-5 PROSPERO
low complexity region 847 861 N/A INTRINSIC
low complexity region 897 908 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 944 958 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185904
AA Change: I133V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140492
Gene: ENSMUSG00000028451
AA Change: I133V

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:FAM75 99 149 2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189414
Predicted Effect probably benign
Transcript: ENSMUST00000190902
AA Change: I157V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140363
Gene: ENSMUSG00000028451
AA Change: I157V

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik C T 16: 88,759,086 P63S unknown Het
Aadac T C 3: 60,039,732 S284P probably damaging Het
Casp12 G A 9: 5,354,612 C257Y probably benign Het
Chil6 T A 3: 106,388,924 I361F possibly damaging Het
Cubn A C 2: 13,476,064 S327A probably damaging Het
Desi2 A T 1: 178,244,377 E82D possibly damaging Het
Dym T A 18: 75,056,641 I100N probably damaging Het
Gm14418 G T 2: 177,387,830 T124K probably benign Het
Gm28042 T A 2: 120,039,683 I701N probably damaging Het
Gm3404 C A 5: 146,527,708 A173D probably damaging Het
Hipk1 A T 3: 103,753,405 L738Q probably damaging Het
Klk10 G T 7: 43,784,900 D239Y possibly damaging Het
Kmt2a T C 9: 44,819,835 probably benign Het
Lepr T A 4: 101,765,305 D427E probably damaging Het
Lrp5 G A 19: 3,652,287 R177W probably damaging Het
Mtg2 A G 2: 180,085,508 T318A probably benign Het
Myh7 A G 14: 54,982,280 V1044A probably benign Het
Nrsn2 A G 2: 152,369,910 V67A probably benign Het
Olfr222 T C 11: 59,570,840 D300G possibly damaging Het
Pcdha8 A G 18: 36,993,797 E444G probably damaging Het
Pdgfra T C 5: 75,162,101 probably benign Het
Pik3c2a T C 7: 116,340,225 probably null Het
Prpf40a T G 2: 53,141,626 probably benign Het
Reln A C 5: 21,929,134 Y2599D probably damaging Het
Sept11 T A 5: 93,139,552 I42N probably damaging Het
Slc22a15 G A 3: 101,875,706 A216V possibly damaging Het
Slc33a1 T A 3: 63,953,906 T292S probably benign Het
Slc5a11 A G 7: 123,238,155 K56R probably benign Het
Slc7a13 G A 4: 19,839,534 G379E probably damaging Het
Specc1l A G 10: 75,246,549 E593G probably damaging Het
Spef2 A T 15: 9,625,973 M1169K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vipr1 A G 9: 121,669,565 *460W probably null Het
Zbtb18 T A 1: 177,448,043 L323Q probably damaging Het
Zfyve1 A G 12: 83,594,496 S129P probably benign Het
Other mutations in 1700022I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:1700022I11Rik APN 4 42973982 missense probably benign 0.40
IGL01340:1700022I11Rik APN 4 42971984 missense possibly damaging 0.94
IGL02078:1700022I11Rik APN 4 42972685 missense possibly damaging 0.71
IGL02082:1700022I11Rik APN 4 42970198 missense probably benign 0.00
IGL02993:1700022I11Rik APN 4 42971719 missense probably damaging 0.99
IGL03174:1700022I11Rik APN 4 42970975 missense probably benign 0.00
IGL03188:1700022I11Rik APN 4 42971225 missense possibly damaging 0.56
R0031:1700022I11Rik UTSW 4 42973712 missense probably damaging 0.99
R0179:1700022I11Rik UTSW 4 42972214 missense probably benign 0.00
R0409:1700022I11Rik UTSW 4 42972203 missense probably damaging 0.98
R0422:1700022I11Rik UTSW 4 42972199 missense possibly damaging 0.95
R0462:1700022I11Rik UTSW 4 42973429 missense probably benign
R0467:1700022I11Rik UTSW 4 42972715 missense probably benign
R0677:1700022I11Rik UTSW 4 42970952 nonsense probably null
R0723:1700022I11Rik UTSW 4 42971691 missense probably damaging 0.98
R1479:1700022I11Rik UTSW 4 42972543 missense possibly damaging 0.55
R1586:1700022I11Rik UTSW 4 42971512 missense probably benign 0.03
R1956:1700022I11Rik UTSW 4 42970105 splice site probably null
R2030:1700022I11Rik UTSW 4 42974131 nonsense probably null
R2074:1700022I11Rik UTSW 4 42974171 missense probably benign 0.38
R2162:1700022I11Rik UTSW 4 42972238 missense possibly damaging 0.59
R2419:1700022I11Rik UTSW 4 42974146 missense possibly damaging 0.94
R2939:1700022I11Rik UTSW 4 42972946 missense probably benign 0.04
R3615:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3616:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3981:1700022I11Rik UTSW 4 42971534 missense probably damaging 0.99
R5037:1700022I11Rik UTSW 4 42972195 missense probably benign
R5252:1700022I11Rik UTSW 4 42971706 missense probably benign 0.00
R5526:1700022I11Rik UTSW 4 42972125 missense possibly damaging 0.90
R5642:1700022I11Rik UTSW 4 42971831 missense possibly damaging 0.61
R5935:1700022I11Rik UTSW 4 42971465 missense probably benign
R6082:1700022I11Rik UTSW 4 42972511 missense probably benign 0.27
R6136:1700022I11Rik UTSW 4 42972853 missense probably damaging 0.96
R6361:1700022I11Rik UTSW 4 42972695 missense probably benign 0.05
R6494:1700022I11Rik UTSW 4 42971924 missense possibly damaging 0.94
R7289:1700022I11Rik UTSW 4 42972379 missense probably benign 0.00
R7289:1700022I11Rik UTSW 4 42973252 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CACACCCATCCTGTAGATCTG -3'
(R):5'- GAACCGGGTGCTATTTCTTCC -3'

Sequencing Primer
(F):5'- ATCCTGTAGATCTGAGGGCC -3'
(R):5'- AACCGGGTGCTATTTCTTCCAGATC -3'
Posted On2018-06-22