Incidental Mutation 'R6645:Fam53a'
ID526061
Institutional Source Beutler Lab
Gene Symbol Fam53a
Ensembl Gene ENSMUSG00000037339
Gene Namefamily with sequence similarity 53, member A
Synonyms5430419M09Rik, 2410018C17Rik, DNTNP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33600347-33629635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33600784 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 332 (Q332K)
Ref Sequence ENSEMBL: ENSMUSP00000070770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045329] [ENSMUST00000065119] [ENSMUST00000065162] [ENSMUST00000150033]
Predicted Effect probably benign
Transcript: ENSMUST00000045329
AA Change: Q332K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045539
Gene: ENSMUSG00000037339
AA Change: Q332K

DomainStartEndE-ValueType
Pfam:FAM53 1 299 2.2e-113 PFAM
low complexity region 336 356 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065119
AA Change: Q332K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070770
Gene: ENSMUSG00000037339
AA Change: Q332K

DomainStartEndE-ValueType
Pfam:FAM53 1 299 2.3e-112 PFAM
low complexity region 336 356 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065162
SMART Domains Protein: ENSMUSP00000069521
Gene: ENSMUSG00000037339

DomainStartEndE-ValueType
Pfam:FAM53 1 299 3.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150033
SMART Domains Protein: ENSMUSP00000117350
Gene: ENSMUSG00000037339

DomainStartEndE-ValueType
Pfam:FAM53 1 54 4e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Fam53a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Fam53a APN 5 33600827 missense probably benign 0.09
IGL02326:Fam53a APN 5 33600594 missense probably damaging 1.00
IGL02939:Fam53a APN 5 33607759 missense probably damaging 1.00
IGL02988:Fam53a UTSW 5 33607475 missense probably damaging 1.00
R0054:Fam53a UTSW 5 33607732 missense probably damaging 0.99
R0884:Fam53a UTSW 5 33600816 missense probably benign 0.00
R4601:Fam53a UTSW 5 33600663 missense probably benign 0.00
R4808:Fam53a UTSW 5 33607679 missense probably damaging 1.00
R5311:Fam53a UTSW 5 33607736 missense probably damaging 1.00
R6334:Fam53a UTSW 5 33600875 missense probably damaging 1.00
R6525:Fam53a UTSW 5 33607918 missense probably damaging 0.99
R6681:Fam53a UTSW 5 33607840 missense probably damaging 1.00
R6814:Fam53a UTSW 5 33610485 missense probably benign 0.35
R7542:Fam53a UTSW 5 33607471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTCAGCCAAAGTCAGTTG -3'
(R):5'- TCTAGGCAGGCACAATGTTG -3'

Sequencing Primer
(F):5'- AATCTGCTCCAAGTCCAGGTCG -3'
(R):5'- AGGCACAATGTTGTCTTGCAC -3'
Posted On2018-06-22