Incidental Mutation 'R6645:Jph1'
ID526046
Institutional Source Beutler Lab
Gene Symbol Jph1
Ensembl Gene ENSMUSG00000042686
Gene Namejunctophilin 1
SynonymsENSMUSG00000054314, mitsugumin72, JP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location16964560-17097889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17091761 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 226 (S226P)
Ref Sequence ENSEMBL: ENSMUSP00000039072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038382]
Predicted Effect probably damaging
Transcript: ENSMUST00000038382
AA Change: S226P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039072
Gene: ENSMUSG00000042686
AA Change: S226P

DomainStartEndE-ValueType
MORN 12 33 7.31e-1 SMART
MORN 36 56 7.6e1 SMART
MORN 58 79 2.49e-1 SMART
Pfam:MORN 82 99 8.9e-3 PFAM
MORN 104 125 3.72e-4 SMART
MORN 127 148 7.86e-3 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
MORN 279 300 2.07e-2 SMART
MORN 302 323 2.86e-5 SMART
low complexity region 382 400 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186604
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to suckle and die shortly after birth. Mutants exhibit deficiencies of triad junctions and contraction in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Jph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Jph1 APN 1 17091740 missense probably damaging 1.00
IGL01382:Jph1 APN 1 17016156 missense probably damaging 1.00
IGL01936:Jph1 APN 1 17097384 missense probably damaging 0.98
IGL02012:Jph1 APN 1 17097414 missense probably benign 0.00
IGL02142:Jph1 APN 1 17091660 missense probably damaging 0.99
IGL02212:Jph1 APN 1 17091757 missense probably damaging 1.00
IGL02317:Jph1 APN 1 17003923 missense probably benign
IGL02450:Jph1 APN 1 17003977 missense possibly damaging 0.77
IGL02707:Jph1 APN 1 17004451 missense probably benign
R0668:Jph1 UTSW 1 17091671 missense probably damaging 1.00
R0893:Jph1 UTSW 1 17004283 nonsense probably null
R1308:Jph1 UTSW 1 17091694 missense probably damaging 1.00
R1318:Jph1 UTSW 1 16997490 missense probably damaging 1.00
R1495:Jph1 UTSW 1 17091652 missense probably benign
R1712:Jph1 UTSW 1 17097232 missense possibly damaging 0.57
R1916:Jph1 UTSW 1 17092055 missense probably damaging 1.00
R4492:Jph1 UTSW 1 16997546 missense probably damaging 1.00
R4559:Jph1 UTSW 1 17004511 missense probably benign
R4565:Jph1 UTSW 1 17004202 missense possibly damaging 0.91
R4694:Jph1 UTSW 1 16997505 missense probably damaging 0.98
R4700:Jph1 UTSW 1 17091704 missense possibly damaging 0.82
R4906:Jph1 UTSW 1 17091611 missense probably damaging 1.00
R5029:Jph1 UTSW 1 17091391 missense possibly damaging 0.85
R5256:Jph1 UTSW 1 17091398 missense probably benign 0.38
R5316:Jph1 UTSW 1 17091526 missense probably damaging 1.00
R5691:Jph1 UTSW 1 17004363 missense probably benign 0.21
R6209:Jph1 UTSW 1 17097586 missense probably damaging 0.98
R6380:Jph1 UTSW 1 17091847 missense probably damaging 1.00
R6829:Jph1 UTSW 1 17004423 missense probably damaging 1.00
R7007:Jph1 UTSW 1 17004186 missense possibly damaging 0.85
R7276:Jph1 UTSW 1 17092042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGCCCATGTAGGTTTCC -3'
(R):5'- ATGGCCACAGTGATCCGTTC -3'

Sequencing Primer
(F):5'- TCCGTGGTAGTGGCATCC -3'
(R):5'- AGTGATCCGTTCCCCGCTG -3'
Posted On2018-06-22