Incidental Mutation 'R6801:Gm7298'
ID533337
Institutional Source Beutler Lab
Gene Symbol Gm7298
Ensembl Gene ENSMUSG00000108022
Gene Namepredicted gene 7298
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R6801 (G1)
Quality Score120.008
Status Validated
Chromosome6
Chromosomal Location121732932-121789084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121775809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 837 (T837A)
Ref Sequence ENSEMBL: ENSMUSP00000145242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204124]
Predicted Effect probably benign
Transcript: ENSMUST00000204124
AA Change: T837A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145242
Gene: ENSMUSG00000108022
AA Change: T837A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 4e-18 PFAM
A2M_N_2 449 599 1e-45 SMART
A2M 740 830 2.1e-39 SMART
Pfam:Thiol-ester_cl 963 992 1.9e-15 PFAM
Pfam:A2M_comp 1012 1268 1.6e-90 PFAM
A2M_recep 1378 1465 4.3e-42 SMART
Meta Mutation Damage Score 0.1372 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Gm7298
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Gm7298 UTSW 6 121774050 missense probably benign
R4978:Gm7298 UTSW 6 121733117 critical splice donor site probably null
R4980:Gm7298 UTSW 6 121759239 intron probably null
R6000:Gm7298 UTSW 6 121765079 missense possibly damaging 0.91
R6160:Gm7298 UTSW 6 121764927 missense probably benign 0.28
R6180:Gm7298 UTSW 6 121760823 missense probably benign 0.01
R6243:Gm7298 UTSW 6 121779137 missense possibly damaging 0.88
R6266:Gm7298 UTSW 6 121782704 missense probably damaging 1.00
R6268:Gm7298 UTSW 6 121779073 missense possibly damaging 0.83
R6363:Gm7298 UTSW 6 121788606 missense probably damaging 1.00
R6364:Gm7298 UTSW 6 121779443 missense possibly damaging 0.90
R6527:Gm7298 UTSW 6 121769710 missense probably benign 0.01
R6538:Gm7298 UTSW 6 121776173 missense probably damaging 0.98
R6884:Gm7298 UTSW 6 121760521 missense possibly damaging 0.74
R6935:Gm7298 UTSW 6 121767694 missense probably benign 0.02
R7051:Gm7298 UTSW 6 121775034 critical splice donor site probably null
R7144:Gm7298 UTSW 6 121761587 missense probably damaging 0.99
R7178:Gm7298 UTSW 6 121785896 missense probably damaging 0.98
R7398:Gm7298 UTSW 6 121781953 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCAAGCCTTCTGTGTCAACTTAC -3'
(R):5'- TGACTGGGAGCTTCCTCTTG -3'

Sequencing Primer
(F):5'- AAGCCTTCTGTGTCAACTTACATGAC -3'
(R):5'- AGGATGAGGTGTACCTCT -3'
Posted On2018-09-12