Incidental Mutation 'R6801:Trim12c'
ID533340
Institutional Source Beutler Lab
Gene Symbol Trim12c
Ensembl Gene ENSMUSG00000057143
Gene Nametripartite motif-containing 12C
SynonymsTrim12-2, 9230105E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104338754-104353362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104348130 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 73 (V73E)
Ref Sequence ENSEMBL: ENSMUSP00000116775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000130139]
Predicted Effect probably damaging
Transcript: ENSMUST00000059037
AA Change: V73E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143
AA Change: V73E

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130139
AA Change: V73E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143
AA Change: V73E

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Trim12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Trim12c APN 7 104348215 missense possibly damaging 0.81
IGL01645:Trim12c APN 7 104345054 nonsense probably null
IGL01737:Trim12c APN 7 104348062 missense probably damaging 1.00
IGL02184:Trim12c APN 7 104348223 missense probably benign 0.00
IGL02309:Trim12c APN 7 104344956 missense possibly damaging 0.72
IGL02323:Trim12c APN 7 104348266 missense probably benign 0.00
IGL02656:Trim12c APN 7 104341203 missense probably damaging 1.00
R0127:Trim12c UTSW 7 104340906 unclassified probably null
R0554:Trim12c UTSW 7 104344962 missense probably damaging 0.96
R1480:Trim12c UTSW 7 104348244 missense probably damaging 1.00
R1501:Trim12c UTSW 7 104340888 unclassified probably benign
R2058:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R2059:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R3838:Trim12c UTSW 7 104340868 unclassified probably benign
R3870:Trim12c UTSW 7 104348337 missense probably benign 0.00
R4896:Trim12c UTSW 7 104340948 missense probably damaging 0.99
R6288:Trim12c UTSW 7 104346729 missense probably benign 0.19
R6522:Trim12c UTSW 7 104348324 missense probably benign 0.38
R6562:Trim12c UTSW 7 104345134 splice site probably null
R7016:Trim12c UTSW 7 104348206 missense
X0062:Trim12c UTSW 7 104346680 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCACCTCTTCAATGAGAGCTG -3'
(R):5'- TCACAGCAACTATGGCTTCAC -3'

Sequencing Primer
(F):5'- ACCTCTTCAATGAGAGCTGTTTTG -3'
(R):5'- TTTAAAGGAGGAAGTGACCTGTCCTC -3'
Posted On2018-09-12