Incidental Mutation 'R6805:Galnt5'
ID533514
Institutional Source Beutler Lab
Gene Symbol Galnt5
Ensembl Gene ENSMUSG00000026828
Gene Namepolypeptide N-acetylgalactosaminyltransferase 5
SynonymsppGaNTase-T5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6805 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location57997884-58045860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58035299 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 864 (D864V)
Ref Sequence ENSEMBL: ENSMUSP00000131362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112616
AA Change: D864V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: D864V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 1.3e-33 PFAM
Pfam:Glyco_transf_7C 653 718 1.9e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166729
AA Change: D864V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: D864V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Galnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Galnt5 APN 2 57998973 missense probably benign
IGL00515:Galnt5 APN 2 57999068 missense probably benign 0.02
IGL00950:Galnt5 APN 2 57999132 missense probably benign 0.00
IGL00973:Galnt5 APN 2 57998939 missense probably benign 0.02
IGL01152:Galnt5 APN 2 58025393 missense probably benign 0.17
IGL01305:Galnt5 APN 2 58025342 nonsense probably null
IGL01661:Galnt5 APN 2 57999482 missense probably benign 0.03
IGL01719:Galnt5 APN 2 57998543 missense probably damaging 1.00
IGL02165:Galnt5 APN 2 57998865 missense probably benign
IGL02795:Galnt5 APN 2 58027871 missense probably damaging 1.00
IGL02943:Galnt5 APN 2 57999768 missense probably damaging 1.00
IGL03218:Galnt5 APN 2 57999389 missense possibly damaging 0.59
ANU22:Galnt5 UTSW 2 58025342 nonsense probably null
R0082:Galnt5 UTSW 2 57999035 missense possibly damaging 0.92
R0113:Galnt5 UTSW 2 57998877 missense probably benign
R0445:Galnt5 UTSW 2 57998950 missense probably benign
R0517:Galnt5 UTSW 2 58035373 splice site probably benign
R0609:Galnt5 UTSW 2 58024625 missense possibly damaging 0.90
R0639:Galnt5 UTSW 2 57999395 missense probably benign 0.07
R0646:Galnt5 UTSW 2 57999085 missense probably benign 0.00
R0677:Galnt5 UTSW 2 57998980 nonsense probably null
R1808:Galnt5 UTSW 2 58026125 missense probably benign 0.24
R1927:Galnt5 UTSW 2 57998603 missense probably benign 0.00
R1980:Galnt5 UTSW 2 58024723 critical splice donor site probably null
R2517:Galnt5 UTSW 2 57999413 missense probably benign 0.00
R4044:Galnt5 UTSW 2 57998460 missense probably damaging 1.00
R4154:Galnt5 UTSW 2 57998493 missense probably damaging 1.00
R4411:Galnt5 UTSW 2 57999195 missense probably benign 0.01
R4703:Galnt5 UTSW 2 57998907 missense possibly damaging 0.96
R4767:Galnt5 UTSW 2 58028144 missense possibly damaging 0.91
R5118:Galnt5 UTSW 2 58015003 missense probably damaging 1.00
R5497:Galnt5 UTSW 2 58025328 missense probably damaging 0.99
R5506:Galnt5 UTSW 2 57999625 missense probably benign
R5548:Galnt5 UTSW 2 58014910 missense probably damaging 0.99
R5758:Galnt5 UTSW 2 57998430 missense probably benign 0.19
R5937:Galnt5 UTSW 2 58038937 missense probably benign 0.00
R6237:Galnt5 UTSW 2 58035249 missense probably damaging 0.96
R6959:Galnt5 UTSW 2 57999219 missense probably benign 0.39
R7070:Galnt5 UTSW 2 57998609 missense probably benign 0.00
R7179:Galnt5 UTSW 2 57998609 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGAGTTCGCATGGTCTCAC -3'
(R):5'- TGGTCTTTATACCCTTGAGTGAAAC -3'

Sequencing Primer
(F):5'- GGTCTCACCTATTGCTGATAAAAGG -3'
(R):5'- AAACTTCACACTATCTCTGTTGTTAC -3'
Posted On2018-09-12