Incidental Mutation 'R6860:Pcdhb3'
ID535482
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Nameprotocadherin beta 3
SynonymsPcdhbC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37300799-37304585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37301710 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 243 (T243K)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
AA Change: T243K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: T243K

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37302948 missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37302001 missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37302145 missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37302097 missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37301219 missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37302961 missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37302157 missense possibly damaging 0.48
R1558:Pcdhb3 UTSW 18 37301581 missense probably damaging 1.00
R1713:Pcdhb3 UTSW 18 37303322 missense probably benign
R1728:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37301317 missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37303309 missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37302186 missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37301239 nonsense probably null
R2513:Pcdhb3 UTSW 18 37301240 missense probably damaging 1.00
R2513:Pcdhb3 UTSW 18 37301241 missense probably benign 0.17
R3080:Pcdhb3 UTSW 18 37301482 missense probably damaging 1.00
R3755:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3756:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37302040 missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37301706 missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37302399 missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37301126 missense probably damaging 1.00
R5779:Pcdhb3 UTSW 18 37301467 missense probably benign 0.26
R5848:Pcdhb3 UTSW 18 37301647 missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37301508 missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37302653 missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37302189 missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37301646 missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37300945 intron probably benign
R6425:Pcdhb3 UTSW 18 37302475 missense possibly damaging 0.64
R6896:Pcdhb3 UTSW 18 37301212 missense probably damaging 1.00
R6946:Pcdhb3 UTSW 18 37302619 missense probably damaging 1.00
R7110:Pcdhb3 UTSW 18 37302922 missense possibly damaging 0.87
R7236:Pcdhb3 UTSW 18 37301452 missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37301604 missense probably benign
R7469:Pcdhb3 UTSW 18 37301335 missense probably benign 0.02
X0026:Pcdhb3 UTSW 18 37301764 missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37302339 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTCCAGAACTACACGGTC -3'
(R):5'- AAAGGCCTCCACCATCCTTG -3'

Sequencing Primer
(F):5'- TCCAGAACTACACGGTCTCTCC -3'
(R):5'- GGCCTCTATGTCAACCTCATAAG -3'
Posted On2018-09-12