Incidental Mutation 'R6863:Nmt2'
ID535730
Institutional Source Beutler Lab
Gene Symbol Nmt2
Ensembl Gene ENSMUSG00000026643
Gene NameN-myristoyltransferase 2
SynonymshNMT-2, A930001K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6863 (G1)
Quality Score168.009
Status Validated
Chromosome2
Chromosomal Location3284212-3328877 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 3305304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081932] [ENSMUST00000091504] [ENSMUST00000102989]
Predicted Effect probably null
Transcript: ENSMUST00000081932
SMART Domains Protein: ENSMUSP00000080600
Gene: ENSMUSG00000026643

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 170 327 1e-78 PFAM
Pfam:NMT_C 341 528 2.9e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091504
SMART Domains Protein: ENSMUSP00000089085
Gene: ENSMUSG00000026643

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:NMT 124 283 2e-84 PFAM
Pfam:NMT_C 297 484 1.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102989
SMART Domains Protein: ENSMUSP00000100054
Gene: ENSMUSG00000026643

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 137 296 7.8e-85 PFAM
Pfam:NMT_C 310 497 6.4e-88 PFAM
Meta Mutation Damage Score 0.6696 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two N-myristoyltransferase proteins. N-terminal myristoylation is a lipid modification that is involved in regulating the function and localization of signaling proteins. The encoded protein catalyzes the addition of a myristoyl group to the N-terminal glycine residue of many signaling proteins, including the human immunodeficiency virus type 1 (HIV-1) proteins, Gag and Nef. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Nmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL00784:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL01871:Nmt2 APN 2 3312674 missense probably damaging 1.00
IGL02617:Nmt2 APN 2 3314713 missense probably benign 0.15
Faul UTSW 2 3305304 intron probably null
ANU05:Nmt2 UTSW 2 3314694 missense probably benign
R0278:Nmt2 UTSW 2 3325387 missense probably benign 0.00
R0524:Nmt2 UTSW 2 3305437 missense probably benign
R0743:Nmt2 UTSW 2 3314785 nonsense probably null
R0884:Nmt2 UTSW 2 3314785 nonsense probably null
R1895:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1946:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1957:Nmt2 UTSW 2 3325382 missense possibly damaging 0.95
R2037:Nmt2 UTSW 2 3309581 missense probably damaging 1.00
R2656:Nmt2 UTSW 2 3307013 missense probably benign
R3422:Nmt2 UTSW 2 3284388 missense possibly damaging 0.82
R3835:Nmt2 UTSW 2 3314686 splice site probably benign
R3955:Nmt2 UTSW 2 3312498 missense probably benign 0.00
R4701:Nmt2 UTSW 2 3322641 missense probably benign
R5032:Nmt2 UTSW 2 3284392 missense probably benign
R6373:Nmt2 UTSW 2 3324951 missense probably benign 0.05
R6396:Nmt2 UTSW 2 3314701 missense probably benign 0.18
R6410:Nmt2 UTSW 2 3316178 missense probably damaging 1.00
R6865:Nmt2 UTSW 2 3314729 missense probably damaging 1.00
R7100:Nmt2 UTSW 2 3312913 missense probably benign
R7139:Nmt2 UTSW 2 3284315 missense probably benign 0.01
X0067:Nmt2 UTSW 2 3324961 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTTACAGCCTCCCTGAAGTTG -3'
(R):5'- AGACCAGGCCGATTCAAAG -3'

Sequencing Primer
(F):5'- CCAAGAGGTGCATACTCTGTG -3'
(R):5'- GGCCGATTCAAAGTCAACAG -3'
Posted On2018-10-18