Incidental Mutation 'R6815:Cd180'
ID537298
Institutional Source Beutler Lab
Gene Symbol Cd180
Ensembl Gene ENSMUSG00000021624
Gene NameCD180 antigen
SynonymsLy78, RP105
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location102693558-102739629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102705429 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 328 (L328F)
Ref Sequence ENSEMBL: ENSMUSP00000022124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]
PDB Structure
Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022124
AA Change: L328F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: L328F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 76 99 1.07e0 SMART
LRR 193 221 1.76e2 SMART
LRR 297 320 1.66e1 SMART
Pfam:LRR_8 321 382 4.2e-13 PFAM
LRR 395 418 3e1 SMART
LRR 444 467 3.09e1 SMART
LRR 495 518 4.97e0 SMART
LRR 519 542 2.4e1 SMART
low complexity region 555 567 N/A INTRINSIC
LRRCT 577 626 5.11e-8 SMART
transmembrane domain 628 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167144
SMART Domains Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171267
SMART Domains Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 2e-38 PDB
SCOP:d1m0za_ 35 84 9e-4 SMART
Blast:LRR 51 75 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in Cd180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cd180 APN 13 102705409 missense probably benign
IGL00949:Cd180 APN 13 102693760 missense possibly damaging 0.89
IGL01864:Cd180 APN 13 102706033 missense possibly damaging 0.93
IGL01901:Cd180 APN 13 102706428 missense probably benign 0.04
IGL01934:Cd180 APN 13 102702858 missense probably damaging 1.00
IGL01998:Cd180 APN 13 102705214 missense probably damaging 0.99
IGL02336:Cd180 APN 13 102705313 missense probably damaging 0.98
IGL03031:Cd180 APN 13 102705027 missense probably benign 0.00
IGL03139:Cd180 APN 13 102706416 missense probably damaging 1.00
H8562:Cd180 UTSW 13 102705418 missense probably benign 0.02
R0004:Cd180 UTSW 13 102702708 missense probably benign 0.00
R0393:Cd180 UTSW 13 102705900 missense probably damaging 0.99
R0565:Cd180 UTSW 13 102702874 intron probably benign
R1080:Cd180 UTSW 13 102706220 nonsense probably null
R1223:Cd180 UTSW 13 102706222 missense possibly damaging 0.49
R1669:Cd180 UTSW 13 102705490 missense probably damaging 1.00
R1772:Cd180 UTSW 13 102706242 missense probably benign 0.11
R1784:Cd180 UTSW 13 102705859 missense probably damaging 1.00
R1865:Cd180 UTSW 13 102706009 missense probably benign
R2252:Cd180 UTSW 13 102706398 nonsense probably null
R2385:Cd180 UTSW 13 102705183 missense probably benign 0.00
R4653:Cd180 UTSW 13 102704908 missense probably damaging 1.00
R4695:Cd180 UTSW 13 102705760 missense probably benign 0.01
R4790:Cd180 UTSW 13 102702822 missense probably damaging 0.98
R4934:Cd180 UTSW 13 102739164 critical splice acceptor site probably null
R5052:Cd180 UTSW 13 102704895 missense probably benign
R5154:Cd180 UTSW 13 102705774 missense probably damaging 1.00
R5469:Cd180 UTSW 13 102704834 missense probably benign 0.37
R5493:Cd180 UTSW 13 102706141 missense probably benign 0.07
R5615:Cd180 UTSW 13 102706203 missense probably benign 0.34
R5905:Cd180 UTSW 13 102706033 missense possibly damaging 0.93
R6282:Cd180 UTSW 13 102693757 missense possibly damaging 0.90
R6433:Cd180 UTSW 13 102705633 missense probably benign 0.00
R6456:Cd180 UTSW 13 102702836 missense probably damaging 1.00
R6784:Cd180 UTSW 13 102702705 missense probably damaging 0.97
R6838:Cd180 UTSW 13 102702731 missense probably benign 0.38
R6941:Cd180 UTSW 13 102706191 missense probably benign 0.23
R7048:Cd180 UTSW 13 102704923 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGAAATGTCTGTGGAGAGC -3'
(R):5'- GCTCAAGTTCAGGCTCTGTAAG -3'

Sequencing Primer
(F):5'- TGTCTGTGGAGAGCATCAACCTAC -3'
(R):5'- TCAAGTTCAGGCTCTGTAAGTGAGAC -3'
Posted On2018-10-18