Incidental Mutation 'R6815:4931414P19Rik'
ID537299
Institutional Source Beutler Lab
Gene Symbol 4931414P19Rik
Ensembl Gene ENSMUSG00000022179
Gene NameRIKEN cDNA 4931414P19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54583663-54605993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54591153 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 297 (N297T)
Ref Sequence ENSEMBL: ENSMUSP00000022786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022786]
Predicted Effect probably damaging
Transcript: ENSMUST00000022786
AA Change: N297T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022786
Gene: ENSMUSG00000022179
AA Change: N297T

DomainStartEndE-ValueType
Pfam:DUF4616 2 538 1.5e-263 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in 4931414P19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:4931414P19Rik APN 14 54595578 missense possibly damaging 0.56
IGL01448:4931414P19Rik APN 14 54585960 missense possibly damaging 0.77
IGL01934:4931414P19Rik APN 14 54585655 missense probably damaging 1.00
IGL02194:4931414P19Rik APN 14 54591355 nonsense probably null
IGL02721:4931414P19Rik APN 14 54585745 missense probably damaging 1.00
IGL03124:4931414P19Rik APN 14 54595139 missense probably benign 0.00
R0575:4931414P19Rik UTSW 14 54591252 missense possibly damaging 0.62
R2049:4931414P19Rik UTSW 14 54584987 nonsense probably null
R3829:4931414P19Rik UTSW 14 54584509 missense probably damaging 1.00
R3876:4931414P19Rik UTSW 14 54591400 nonsense probably null
R4392:4931414P19Rik UTSW 14 54584978 critical splice donor site probably null
R4680:4931414P19Rik UTSW 14 54585076 missense probably damaging 1.00
R4805:4931414P19Rik UTSW 14 54595454 missense probably benign 0.00
R4940:4931414P19Rik UTSW 14 54591325 missense probably benign
R5091:4931414P19Rik UTSW 14 54585711 missense probably damaging 1.00
R5291:4931414P19Rik UTSW 14 54585937 missense probably damaging 1.00
R5594:4931414P19Rik UTSW 14 54584984 missense probably damaging 1.00
R7031:4931414P19Rik UTSW 14 54595601 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTTGCCAATGCTCCAGGTTATG -3'
(R):5'- CAATTGGCTATCCAGAGGGC -3'

Sequencing Primer
(F):5'- CCAATGCTCCAGGTTATGCAGTAAG -3'
(R):5'- GCATCCTCAGAGACAGGC -3'
Posted On2018-10-18