Incidental Mutation 'R6958:Gfm2'
ID541601
Institutional Source Beutler Lab
Gene Symbol Gfm2
Ensembl Gene ENSMUSG00000021666
Gene NameG elongation factor, mitochondrial 2
SynonymsEFG2, MST027, A930009M04Rik, 6530419G12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location97137937-97181195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97146236 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 75 (I75V)
Ref Sequence ENSEMBL: ENSMUSP00000125306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000160139] [ENSMUST00000161639] [ENSMUST00000161825] [ENSMUST00000161913] [ENSMUST00000161929]
Predicted Effect probably damaging
Transcript: ENSMUST00000022170
AA Change: I73V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666
AA Change: I73V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042084
AA Change: I75V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666
AA Change: I75V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160139
AA Change: I75V

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124426
Gene: ENSMUSG00000021666
AA Change: I75V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 241 3.5e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160981
Predicted Effect probably damaging
Transcript: ENSMUST00000161639
AA Change: I75V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666
AA Change: I75V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161825
AA Change: I75V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666
AA Change: I75V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161913
AA Change: I75V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124253
Gene: ENSMUSG00000021666
AA Change: I75V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 3.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 3.2e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 532 2.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161929
AA Change: I75V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125306
Gene: ENSMUSG00000021666
AA Change: I75V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 94 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors, which is a GTPase that plays a role at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA . Its role in the regulation of normal mitochondrial function and in disease states attributed to mitochondrial dysfunction is not known. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Gfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gfm2 APN 13 97155442 missense probably benign 0.38
IGL00781:Gfm2 APN 13 97149339 missense probably damaging 1.00
IGL00789:Gfm2 APN 13 97173058 unclassified probably benign
IGL00978:Gfm2 APN 13 97162977 missense probably benign 0.20
IGL01637:Gfm2 APN 13 97150409 missense probably damaging 1.00
IGL02318:Gfm2 APN 13 97162975 missense probably damaging 1.00
R0825:Gfm2 UTSW 13 97143104 splice site probably benign
R1173:Gfm2 UTSW 13 97165200 splice site probably null
R1847:Gfm2 UTSW 13 97162934 missense probably benign 0.04
R1932:Gfm2 UTSW 13 97141967 missense probably damaging 0.96
R2104:Gfm2 UTSW 13 97171520 missense probably damaging 0.99
R2108:Gfm2 UTSW 13 97155442 missense probably benign 0.38
R2877:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2878:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2898:Gfm2 UTSW 13 97172961 missense possibly damaging 0.85
R3931:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R4011:Gfm2 UTSW 13 97143100 splice site probably benign
R4831:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R4921:Gfm2 UTSW 13 97175676 missense probably damaging 0.99
R5182:Gfm2 UTSW 13 97162893 missense probably damaging 1.00
R5309:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5310:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5311:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5339:Gfm2 UTSW 13 97175040 missense probably benign
R5594:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R5599:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R6014:Gfm2 UTSW 13 97151661 intron probably null
R6041:Gfm2 UTSW 13 97172623 missense probably benign 0.11
R6108:Gfm2 UTSW 13 97149422 missense possibly damaging 0.79
R6345:Gfm2 UTSW 13 97162953 missense probably damaging 0.96
R6596:Gfm2 UTSW 13 97165149 missense probably damaging 1.00
R6937:Gfm2 UTSW 13 97163064 splice site probably null
R6996:Gfm2 UTSW 13 97149360 missense probably damaging 1.00
R7291:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R7365:Gfm2 UTSW 13 97143021 missense probably benign 0.06
R7456:Gfm2 UTSW 13 97145703 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGATGTCATAGTGCGCCC -3'
(R):5'- GTTTAGACACCAGAGACTCCATG -3'

Sequencing Primer
(F):5'- ATGTCATAGTGCGCCCCCTAG -3'
(R):5'- ATGCCTCACGCTAGTTGACG -3'
Posted On2018-11-28