Incidental Mutation 'R0609:Stard9'
ID54491
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 038798-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R0609 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120706306 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 4186 (D4186V)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154193
AA Change: D410V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: D410V

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: D4186V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: D4186V

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A T 14: 35,811,461 probably null Het
Abcb4 T A 5: 8,947,376 C952S probably damaging Het
Adamtsl2 A G 2: 27,089,635 D272G probably benign Het
Aim2 G A 1: 173,461,964 D158N probably damaging Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Apoc2 A G 7: 19,673,353 S28P probably benign Het
Arfgef3 G A 10: 18,597,431 T1628I probably benign Het
Atp10a G A 7: 58,819,740 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
Brsk2 T C 7: 141,998,492 Y618H probably damaging Het
Casp12 T A 9: 5,346,554 F27Y probably damaging Het
Casp8 T A 1: 58,844,792 N439K probably benign Het
Ccdc175 T A 12: 72,157,507 K253N probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cdk17 T C 10: 93,216,472 M105T probably benign Het
Cdon C A 9: 35,478,611 P854T probably damaging Het
Cep44 A G 8: 56,544,152 M117T possibly damaging Het
Cep89 A T 7: 35,435,530 E674D probably damaging Het
Cit C T 5: 115,873,943 A203V probably damaging Het
Clstn1 C A 4: 149,629,300 probably null Het
Col7a1 T A 9: 108,958,147 D565E unknown Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Cps1 T G 1: 67,172,802 Y710D probably damaging Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dars A G 1: 128,405,381 V102A probably benign Het
Dhx35 C T 2: 158,817,415 T168I possibly damaging Het
Dnah5 T C 15: 28,327,779 S2100P probably benign Het
Dst T C 1: 34,266,960 probably null Het
Egflam A C 15: 7,253,523 L351R possibly damaging Het
Elp2 T A 18: 24,626,156 D523E probably benign Het
Exo5 C A 4: 120,921,684 G328V probably damaging Het
Fam208a C T 14: 27,461,750 T722I probably benign Het
Fut9 A G 4: 25,620,811 M1T probably null Het
Galnt5 A G 2: 58,024,625 N584S possibly damaging Het
Gbp3 T C 3: 142,567,772 V360A probably damaging Het
Gdf6 G A 4: 9,859,977 C353Y probably damaging Het
Gm13089 A T 4: 143,698,503 D123E probably benign Het
Hace1 A G 10: 45,648,869 T244A probably damaging Het
Hr T C 14: 70,559,657 I500T probably benign Het
Ifnl2 A T 7: 28,509,282 L115Q probably damaging Het
Iigp1 T C 18: 60,389,824 F5L probably benign Het
Inhbb A G 1: 119,417,416 L381P probably damaging Het
Irx3 A T 8: 91,801,093 S50T probably benign Het
Ivns1abp C T 1: 151,360,145 T363I probably benign Het
Izumo1 A T 7: 45,622,899 T35S probably benign Het
Kank4 A G 4: 98,777,105 S651P probably damaging Het
Kit T C 5: 75,610,879 V232A probably benign Het
Klhl11 T C 11: 100,463,714 Y427C probably damaging Het
Laptm4b T A 15: 34,258,689 N36K probably damaging Het
Lrrk1 T C 7: 66,266,615 probably null Het
Mamdc4 G T 2: 25,564,193 Q1042K probably benign Het
Mical2 A G 7: 112,321,440 probably null Het
Ms4a3 C A 19: 11,631,361 V176F possibly damaging Het
Myo3a T C 2: 22,333,513 V427A probably benign Het
Myo3a A C 2: 22,396,299 E626D possibly damaging Het
Nckap5 A T 1: 126,027,288 L509* probably null Het
Ndufa5 A T 6: 24,519,249 D64E possibly damaging Het
Nedd4l T C 18: 65,208,461 Y753H probably damaging Het
Nynrin T C 14: 55,872,761 V1775A probably damaging Het
Olfr141 A G 2: 86,806,861 L46S probably damaging Het
Olfr292 T C 7: 86,694,876 V140A possibly damaging Het
Olfr694 A T 7: 106,688,998 H244Q probably damaging Het
Olfr735 T C 14: 50,345,926 Y141C probably damaging Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Oplah A G 15: 76,302,992 S570P probably benign Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Osbpl5 A T 7: 143,694,821 L644Q probably damaging Het
Pcdhb19 T C 18: 37,497,952 W267R probably benign Het
Pkhd1l1 A C 15: 44,467,424 S132R possibly damaging Het
Ptpn13 T A 5: 103,556,145 S1348T probably benign Het
Rc3h1 T A 1: 160,930,135 W8R probably damaging Het
Rgs3 T G 4: 62,625,936 V315G probably damaging Het
Rora T A 9: 69,361,869 M82K probably damaging Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Sag T C 1: 87,812,991 V45A probably damaging Het
Scn3a T C 2: 65,536,510 E56G probably damaging Het
Sec24c T G 14: 20,686,948 V324G probably damaging Het
Sptbn1 A G 11: 30,138,979 L748S probably damaging Het
Stk39 T C 2: 68,366,167 E306G probably damaging Het
Sycp1 C A 3: 102,898,849 probably null Het
Taf2 A C 15: 55,060,050 L277R probably damaging Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tekt5 T C 16: 10,361,304 T400A possibly damaging Het
Tgfbrap1 T C 1: 43,060,141 H401R probably benign Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tln1 T G 4: 43,544,645 T1095P possibly damaging Het
Tmem147 A G 7: 30,728,102 Y72H probably benign Het
Tnfaip2 A G 12: 111,453,507 N691S probably benign Het
Trim24 G A 6: 37,957,783 C811Y probably damaging Het
Trim30b T A 7: 104,357,976 probably benign Het
Trpc4 T G 3: 54,194,768 L29R probably damaging Het
Trpm6 A T 19: 18,825,862 I890F probably damaging Het
Ttc23l C T 15: 10,504,536 E442K probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Ugt1a6a C A 1: 88,138,884 S137R probably benign Het
Unc13a A G 8: 71,658,467 Y367H probably damaging Het
Vmn2r49 A G 7: 9,976,306 I833T probably benign Het
Vmn2r7 T C 3: 64,716,479 D231G probably benign Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zcchc6 A T 13: 59,799,782 C506* probably null Het
Zfp804a G A 2: 82,257,588 S587N probably damaging Het
Zswim2 A G 2: 83,923,659 I219T probably benign Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense not run
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATGGCTTGCTCCTCCTTAGAAACC -3'
(R):5'- TTTGGGCTGGAAGCAGAACCCTAC -3'

Sequencing Primer
(F):5'- TCCTTAGAAACCTCTCCTAAGAATG -3'
(R):5'- CATGCAGAGTGAAGGCTACC -3'
Posted On2013-07-11