Incidental Mutation 'R7132:Stard9'
ID552727
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 120679378 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 266 (K266*)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000180041]
Predicted Effect probably null
Transcript: ENSMUST00000140843
AA Change: K266*
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705
AA Change: K266*

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000180041
AA Change: K266*
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: K266*

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
PIT4151001:Stard9 UTSW 2 120702756 nonsense probably null
PIT4498001:Stard9 UTSW 2 120697435 missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7151:Stard9 UTSW 2 120696142 missense probably benign
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTTCTGTTTGTATCCAGAAAGAG -3'
(R):5'- CTGGAATGATGGTCACTCATATGC -3'

Sequencing Primer
(F):5'- TGTATCCAGAAAGAGGAAAAATGTTG -3'
(R):5'- TGGTCACTCATATGCTAAAAACAAC -3'
Posted On2019-05-15