Incidental Mutation 'R7013:Impg1'
ID545131
Institutional Source Beutler Lab
Gene Symbol Impg1
Ensembl Gene ENSMUSG00000032343
Gene Nameinterphotoreceptor matrix proteoglycan 1
SynonymsIMP150, SPACR, A930015H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location80313330-80465481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80378494 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 409 (S409R)
Ref Sequence ENSEMBL: ENSMUSP00000108876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085289] [ENSMUST00000113250]
Predicted Effect probably damaging
Transcript: ENSMUST00000085289
AA Change: S332R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: S332R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 158 273 8.68e-1 SMART
low complexity region 353 374 N/A INTRINSIC
SEA 494 616 1.37e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113250
AA Change: S409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: S409R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 235 350 8.68e-1 SMART
low complexity region 430 451 N/A INTRINSIC
SEA 571 693 1.37e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Impg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Impg1 APN 9 80322829 missense probably benign 0.02
IGL01733:Impg1 APN 9 80341924 missense probably damaging 0.99
IGL02333:Impg1 APN 9 80440755 missense possibly damaging 0.74
IGL03097:Impg1 UTSW 9 80379952 missense possibly damaging 0.48
R0021:Impg1 UTSW 9 80435426 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0108:Impg1 UTSW 9 80322848 missense possibly damaging 0.63
R0201:Impg1 UTSW 9 80345561 missense probably damaging 1.00
R0271:Impg1 UTSW 9 80386879 splice site probably benign
R0316:Impg1 UTSW 9 80342065 missense probably damaging 1.00
R0492:Impg1 UTSW 9 80345308 missense possibly damaging 0.74
R0633:Impg1 UTSW 9 80394155 missense possibly damaging 0.72
R0705:Impg1 UTSW 9 80379979 missense probably damaging 1.00
R0962:Impg1 UTSW 9 80381741 missense probably benign 0.23
R1264:Impg1 UTSW 9 80314393 missense probably benign 0.31
R1707:Impg1 UTSW 9 80378517 splice site probably null
R2017:Impg1 UTSW 9 80440667 missense probably damaging 1.00
R3904:Impg1 UTSW 9 80345585 missense possibly damaging 0.76
R3960:Impg1 UTSW 9 80440864 missense probably benign 0.00
R4231:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4233:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4235:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4236:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4490:Impg1 UTSW 9 80394059 missense probably damaging 1.00
R4592:Impg1 UTSW 9 80440854 missense probably benign 0.05
R4701:Impg1 UTSW 9 80314400 missense probably benign 0.07
R4785:Impg1 UTSW 9 80398450 missense probably benign 0.01
R4796:Impg1 UTSW 9 80394095 missense probably damaging 0.99
R4923:Impg1 UTSW 9 80345078 nonsense probably null
R4923:Impg1 UTSW 9 80345545 missense probably damaging 0.98
R5468:Impg1 UTSW 9 80465265 missense probably benign 0.05
R5596:Impg1 UTSW 9 80345218 missense probably benign 0.24
R6001:Impg1 UTSW 9 80316172 missense probably benign 0.12
R6156:Impg1 UTSW 9 80322824 missense probably damaging 1.00
R6315:Impg1 UTSW 9 80394074 missense probably benign 0.21
R6419:Impg1 UTSW 9 80380018 missense probably benign 0.38
R6880:Impg1 UTSW 9 80404800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATGCTGGAGAGACAAACC -3'
(R):5'- GATCAGGAACTAGATTGCCAGGC -3'

Sequencing Primer
(F):5'- ACCTTCCCAGGGTAGAGATGAC -3'
(R):5'- CAGGCCATGTGGTCCTTTCAG -3'
Posted On2019-05-13