Incidental Mutation 'R7084:Myo1e'
ID549765
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7084 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70337801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 394 (I394V)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034745
AA Change: I394V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: I394V

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,488,185 D8E unknown Het
4931440F15Rik G T 11: 29,825,009 H149Q probably damaging Het
Abca5 T A 11: 110,301,545 I714L probably benign Het
Abce1 T A 8: 79,699,414 S245C probably benign Het
Abcg1 T A 17: 31,106,131 D310E probably benign Het
Adhfe1 T A 1: 9,566,805 I394N probably benign Het
Apob A T 12: 8,009,591 D2691V probably benign Het
Arhgap18 A G 10: 26,872,738 T340A possibly damaging Het
Arsb A T 13: 93,940,616 Q497L probably benign Het
Asic5 T C 3: 82,012,011 I354T probably benign Het
Atp6v0a1 T C 11: 101,034,042 C318R probably damaging Het
Cftr T C 6: 18,226,138 Y362H probably benign Het
Crip3 T C 17: 46,430,790 Y113H probably benign Het
Dcaf4 AT A 12: 83,537,797 probably null Het
Dock10 T A 1: 80,503,856 I475F Het
Dqx1 T A 6: 83,066,455 Y674N probably damaging Het
Dync2h1 G T 9: 7,113,214 Q2437K possibly damaging Het
Ednra A T 8: 77,665,105 C385* probably null Het
Fam216a G A 5: 122,369,560 T68I probably benign Het
Fbxw22 A G 9: 109,404,223 L14P probably damaging Het
Fkbp10 A G 11: 100,421,303 I230V possibly damaging Het
Ggn C A 7: 29,172,998 A637E probably damaging Het
Gm156 C A 6: 129,766,710 A204S possibly damaging Het
Hcrtr2 T C 9: 76,230,660 D391G probably benign Het
Heatr5b A T 17: 78,810,563 V817D possibly damaging Het
Il1f10 G A 2: 24,293,670 W120* probably null Het
Irf5 C A 6: 29,535,877 R297S probably damaging Het
Jak2 A G 19: 29,286,398 T438A possibly damaging Het
Jsrp1 T C 10: 80,808,576 D332G possibly damaging Het
Kank4 A T 4: 98,771,345 V832D probably damaging Het
Kcnip3 C T 2: 127,510,936 S25N probably benign Het
Klk1b16 C T 7: 44,139,486 H48Y probably benign Het
Krtap5-4 G A 7: 142,303,872 C93Y unknown Het
Lacc1 T A 14: 77,029,656 Q389L probably benign Het
Lin9 C A 1: 180,688,096 T477K probably benign Het
Lpar2 A T 8: 69,823,606 N15I probably damaging Het
Ltbp2 C A 12: 84,868,685 C200F probably damaging Het
Mall G T 2: 127,708,873 H122Q probably benign Het
Mast3 T C 8: 70,779,473 I1287V probably benign Het
Mindy4 T C 6: 55,278,235 I566T probably benign Het
Mme T C 3: 63,328,217 Y195H probably damaging Het
Mpzl1 T C 1: 165,604,698 T173A probably benign Het
Mri1 G T 8: 84,251,079 T209N Het
Nat14 T C 7: 4,924,330 V167A possibly damaging Het
Nfasc A G 1: 132,570,509 Y1212H unknown Het
Nsun7 T A 5: 66,295,421 L493Q probably damaging Het
Obsl1 A T 1: 75,487,750 S1637R probably benign Het
Ocstamp A T 2: 165,398,037 Y76* probably null Het
Olfr1443 A C 19: 12,680,834 H242P probably damaging Het
Olfr769 T A 10: 129,111,547 K293* probably null Het
Olfr917 G A 9: 38,665,269 R192C probably benign Het
Otog T A 7: 46,298,566 C145* probably null Het
Padi6 T A 4: 140,741,558 K5* probably null Het
Pcdha5 T A 18: 36,961,562 S375T probably benign Het
Pde10a C T 17: 8,941,162 P140S probably benign Het
Pgbd1 C G 13: 21,423,130 C298S possibly damaging Het
Plch2 C T 4: 154,986,991 G977D probably benign Het
Pou2f3 T C 9: 43,128,893 T367A probably damaging Het
Ppm1j T A 3: 104,784,960 Y352N probably damaging Het
Prkag2 T C 5: 25,021,969 T97A probably benign Het
Rpl36a-ps1 T A 14: 98,994,224 Y26F probably benign Het
Sctr A T 1: 120,063,271 N445Y possibly damaging Het
Serping1 C T 2: 84,773,491 V69I probably benign Het
Slc8a2 T A 7: 16,145,038 L483Q probably benign Het
Spag17 T C 3: 99,939,270 F37L probably benign Het
Srrm2 T A 17: 23,820,316 M1978K probably damaging Het
Tcp11 T C 17: 28,067,021 Q540R probably benign Het
Thnsl1 G T 2: 21,212,330 R298S possibly damaging Het
Tigd5 T A 15: 75,910,381 Y197* probably null Het
Tmprss11g A T 5: 86,492,200 L203Q probably damaging Het
Trim35 T A 14: 66,308,822 V346E probably damaging Het
Ttn T C 2: 76,768,364 I19402V possibly damaging Het
Ttn C T 2: 76,919,345 E3787K probably benign Het
Tut1 G A 19: 8,965,414 V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 I18V probably benign Het
Zbbx T C 3: 75,139,546 N22S possibly damaging Het
Zfp169 A C 13: 48,498,863 M26R probably benign Het
Zfp180 T A 7: 24,105,261 H368Q probably damaging Het
Zfp638 T A 6: 83,953,126 S770T possibly damaging Het
Znrf1 T C 8: 111,537,142 M1T probably null Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAATGTGGTTGCCGTGCAG -3'
(R):5'- ATCATGAGTTGGCCTGCAGG -3'

Sequencing Primer
(F):5'- GGTAGCTCACAACCATCTGTAATG -3'
(R):5'- CCCTCACTGTGAAGGCAGAGATG -3'
Posted On2019-05-15