Incidental Mutation 'R7126:Mroh2a'
ID552298
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R7126 (G1)
Quality Score85.0076
Status Not validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88254935 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1195 (R1195L)
Ref Sequence ENSEMBL: ENSMUSP00000130508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061013
AA Change: R1195L

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: R1195L

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113130
AA Change: R1192L

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: R1192L

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135948
SMART Domains Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
SCOP:d1gw5a_ 15 174 5e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acadsb T C 7: 131,437,448 I316T probably benign Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Cbs T A 17: 31,619,139 M379L probably benign Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm4779 GGG GGGCCCGG X: 101,794,173 probably null Het
Gm4779 GGGGCC GGGGCCCGGGCC X: 101,794,185 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Grid2 T A 6: 64,076,810 V331E probably damaging Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Klhl12 A G 1: 134,467,783 H161R probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1355 T C 10: 78,879,577 V135A possibly damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scn7a G T 2: 66,757,286 H24Q possibly damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Spag17 T G 3: 100,101,435 N1960K probably benign Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers
Posted On2019-05-15