Incidental Mutation 'PIT4434001:Taar7a'
ID555069
Institutional Source Beutler Lab
Gene Symbol Taar7a
Ensembl Gene ENSMUSG00000095647
Gene Nametrace amine-associated receptor 7A
SynonymsTaar7a, LOC215856
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #PIT4434001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23992405-23993481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23993421 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 21 (F21L)
Ref Sequence ENSEMBL: ENSMUSP00000077616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078532]
Predicted Effect probably benign
Transcript: ENSMUST00000078532
AA Change: F21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077616
Gene: ENSMUSG00000095647
AA Change: F21L

DomainStartEndE-ValueType
Pfam:7tm_4 54 344 9.2e-10 PFAM
Pfam:7TM_GPCR_Srx 56 261 5.2e-9 PFAM
Pfam:7tm_1 64 326 3.2e-58 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T A 11: 117,806,043 D196E probably benign Het
Abcb5 G A 12: 118,890,687 S831F probably damaging Het
Alg2 C A 4: 47,474,076 A71S probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Ano1 A G 7: 144,610,895 V664A probably benign Het
Bbox1 A C 2: 110,275,634 D188E probably benign Het
Bmi1 C T 2: 18,684,231 T242M probably benign Het
C4bp A G 1: 130,657,210 F30L probably benign Het
Carmil3 A G 14: 55,494,688 N214S probably null Het
Cep162 C A 9: 87,193,648 K1310N probably damaging Het
Cfap74 G A 4: 155,463,964 V21M unknown Het
Copa A G 1: 172,106,175 D401G probably benign Het
Cyp4f14 A G 17: 32,906,130 V439A possibly damaging Het
Ddhd1 A C 14: 45,610,605 N569K possibly damaging Het
Dennd5a A G 7: 109,933,624 L313P probably damaging Het
Eri2 A G 7: 119,786,301 F326L probably benign Het
Fam135a A T 1: 24,029,195 H864Q probably benign Het
Fat3 C T 9: 15,996,316 V2797I probably benign Het
Fbn2 T C 18: 58,096,062 D692G probably damaging Het
Fbxw20 A G 9: 109,223,432 S278P probably damaging Het
Gna12 A T 5: 140,761,018 V224E probably damaging Het
Grn C T 11: 102,435,940 H482Y possibly damaging Het
Igkv7-33 A G 6: 70,058,813 Y62H possibly damaging Het
Kdm4c A G 4: 74,271,332 T95A probably benign Het
Lrp3 T C 7: 35,203,995 T309A probably damaging Het
Map3k2 C A 18: 32,210,035 D279E possibly damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Mcpt9 A G 14: 56,029,229 S14P probably benign Het
Olfr1358 T C 10: 78,519,715 F36L possibly damaging Het
Olfr570 T C 7: 102,900,630 F88L probably benign Het
Olfr622 A C 7: 103,639,847 C98G probably damaging Het
Otud7b G A 3: 96,140,465 R45H probably damaging Het
Pcdhb17 A G 18: 37,485,651 N165D probably damaging Het
Pogz A G 3: 94,872,370 T538A probably damaging Het
Prlr A G 15: 10,328,372 E311G probably damaging Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Raet1d A T 10: 22,371,534 K170* probably null Het
Rufy2 A T 10: 62,991,066 Q128L possibly damaging Het
Svopl T C 6: 38,014,866 N360D possibly damaging Het
Syt4 A C 18: 31,440,331 L377W probably damaging Het
Tax1bp3 T A 11: 73,180,804 M78K probably damaging Het
Top2b T C 14: 16,423,780 probably null Het
Trim52 A T 14: 106,107,298 D130V probably benign Het
Ttc1 T C 11: 43,745,128 Y96C probably damaging Het
Vmn2r49 T C 7: 9,976,835 T657A probably damaging Het
Vps13d A T 4: 145,155,247 F1259I Het
Zbtb18 A T 1: 177,448,423 T441S possibly damaging Het
Other mutations in Taar7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Taar7a APN 10 23992396 unclassified probably benign
IGL02408:Taar7a APN 10 23992602 missense probably benign
R0422:Taar7a UTSW 10 23993274 missense probably benign 0.02
R1029:Taar7a UTSW 10 23992541 missense possibly damaging 0.65
R1742:Taar7a UTSW 10 23993219 missense probably damaging 0.98
R2104:Taar7a UTSW 10 23993061 missense probably damaging 0.99
R2421:Taar7a UTSW 10 23992517 missense probably damaging 1.00
R3907:Taar7a UTSW 10 23992559 missense probably benign 0.25
R4021:Taar7a UTSW 10 23993386 missense probably benign 0.00
R5180:Taar7a UTSW 10 23993148 missense probably damaging 1.00
R5486:Taar7a UTSW 10 23992458 missense probably benign 0.00
R5507:Taar7a UTSW 10 23992631 missense probably damaging 0.98
R5587:Taar7a UTSW 10 23992828 missense probably benign 0.00
R5766:Taar7a UTSW 10 23993362 missense probably benign 0.01
R5861:Taar7a UTSW 10 23992439 missense probably benign
R7201:Taar7a UTSW 10 23992460 missense probably benign 0.04
X0064:Taar7a UTSW 10 23992617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCAGCTGCCTGAAATG -3'
(R):5'- TGACGACTTAAGCCTTAGAGAG -3'

Sequencing Primer
(F):5'- GCTGCCTGAAATGAAGAATTGATGTC -3'
(R):5'- TTCACAGGTACAAGAAGGGA -3'
Posted On2019-06-07