Incidental Mutation 'PIT4544001:Tekt1'
ID556421
Institutional Source Beutler Lab
Gene Symbol Tekt1
Ensembl Gene ENSMUSG00000020799
Gene Nametektin 1
SynonymsMT14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #PIT4544001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72344722-72362442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72354834 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 165 (R165H)
Ref Sequence ENSEMBL: ENSMUSP00000021155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021155] [ENSMUST00000108502] [ENSMUST00000108503]
Predicted Effect probably damaging
Transcript: ENSMUST00000021155
AA Change: R165H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021155
Gene: ENSMUSG00000020799
AA Change: R165H

DomainStartEndE-ValueType
Pfam:Tektin 16 398 1.3e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108502
AA Change: R165H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104142
Gene: ENSMUSG00000020799
AA Change: R165H

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108503
AA Change: R165H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104143
Gene: ENSMUSG00000020799
AA Change: R165H

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is predominantly expressed in the testis and in mouse, tektin 1 mRNA was localized to the spermatocytes and round spermatids in the seminiferous tubules, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Aspn A T 13: 49,553,982 K106* probably null Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Ccdc54 A T 16: 50,589,980 C308S possibly damaging Het
Cpa1 T C 6: 30,641,858 V227A probably benign Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ifit1bl1 C T 19: 34,594,015 M347I possibly damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Nudt21 A T 8: 94,019,597 F158I unknown Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Stxbp5 A C 10: 9,817,304 probably null Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubqln3 A C 7: 104,141,343 H513Q probably damaging Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Tekt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0463:Tekt1 UTSW 11 72351952 missense probably damaging 1.00
R0531:Tekt1 UTSW 11 72345594 missense possibly damaging 0.67
R1190:Tekt1 UTSW 11 72355213 missense probably damaging 1.00
R1908:Tekt1 UTSW 11 72351935 missense probably benign 0.41
R3783:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3784:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3785:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3787:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3831:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3832:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3833:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3916:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R3917:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R5645:Tekt1 UTSW 11 72351837 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTGGCCCTGTCAGATTGATAG -3'
(R):5'- TGATCTCTCAGTCCAGTTTGG -3'

Sequencing Primer
(F):5'- CTGTCAGATTGATAGGATCCGG -3'
(R):5'- ATCTCTCAGTCCAGTTTGGCAGAG -3'
Posted On2019-06-07