Incidental Mutation 'R7161:Pask'
ID557543
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene NamePAS domain containing serine/threonine kinase
SynonymsPaskin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93308770-93343482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93310905 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1286 (S1286N)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027492] [ENSMUST00000027493]
Predicted Effect probably benign
Transcript: ENSMUST00000027492
SMART Domains Protein: ENSMUSP00000027492
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Mterf 142 172 1.28e2 SMART
Mterf 177 208 1.1e1 SMART
Mterf 213 244 3.89e0 SMART
Mterf 246 274 2.06e2 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027493
AA Change: S1286N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: S1286N

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93310852 missense probably benign 0.02
IGL01620:Pask APN 1 93310122 missense possibly damaging 0.87
IGL01959:Pask APN 1 93334607 missense probably benign 0.03
IGL02170:Pask APN 1 93310884 missense possibly damaging 0.69
IGL02499:Pask APN 1 93321095 nonsense probably null
IGL02670:Pask APN 1 93310818 missense probably damaging 1.00
IGL03066:Pask APN 1 93330866 missense probably benign 0.02
IGL03210:Pask APN 1 93319992 missense possibly damaging 0.92
R0472:Pask UTSW 1 93320917 missense probably benign 0.00
R0524:Pask UTSW 1 93310834 missense probably damaging 1.00
R0854:Pask UTSW 1 93327400 missense probably damaging 0.99
R0854:Pask UTSW 1 93327412 missense probably damaging 1.00
R0854:Pask UTSW 1 93327434 missense possibly damaging 0.79
R0863:Pask UTSW 1 93314339 missense probably damaging 1.00
R1052:Pask UTSW 1 93330827 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1831:Pask UTSW 1 93320769 splice site probably null
R1958:Pask UTSW 1 93321458 missense probably benign 0.00
R2143:Pask UTSW 1 93321297 missense probably benign 0.00
R2144:Pask UTSW 1 93321297 missense probably benign 0.00
R2145:Pask UTSW 1 93321297 missense probably benign 0.00
R2509:Pask UTSW 1 93330763 missense possibly damaging 0.62
R2858:Pask UTSW 1 93321651 missense probably benign 0.00
R2899:Pask UTSW 1 93334547 missense probably damaging 1.00
R3545:Pask UTSW 1 93317115 missense probably damaging 1.00
R3778:Pask UTSW 1 93327467 missense probably damaging 1.00
R4111:Pask UTSW 1 93310818 missense probably damaging 1.00
R4514:Pask UTSW 1 93322133 missense probably benign 0.03
R4527:Pask UTSW 1 93320502 missense probably benign
R4580:Pask UTSW 1 93322108 missense probably benign 0.36
R4718:Pask UTSW 1 93322196 missense possibly damaging 0.67
R4775:Pask UTSW 1 93337524 missense probably damaging 0.97
R5036:Pask UTSW 1 93322079 nonsense probably null
R5070:Pask UTSW 1 93330874 missense probably damaging 1.00
R5084:Pask UTSW 1 93322097 missense probably benign
R5151:Pask UTSW 1 93334628 missense probably damaging 1.00
R5196:Pask UTSW 1 93310083 unclassified probably benign
R5643:Pask UTSW 1 93337343 critical splice donor site probably null
R5739:Pask UTSW 1 93322056 missense probably benign
R6126:Pask UTSW 1 93314359 missense probably damaging 1.00
R7284:Pask UTSW 1 93320669 missense probably benign 0.01
R7289:Pask UTSW 1 93331587 missense probably damaging 1.00
Z1088:Pask UTSW 1 93316801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGGATGATCACCTCCC -3'
(R):5'- GGGCTCATAAATGCATTTCCTGAG -3'

Sequencing Primer
(F):5'- GGATGATCACCTCCCCACCC -3'
(R):5'- TTGATGCCCTAGAACTCC -3'
Posted On2019-06-26