Incidental Mutation 'R7166:Cfap221'
ID557912
Institutional Source Beutler Lab
Gene Symbol Cfap221
Ensembl Gene ENSMUSG00000036962
Gene Namecilia and flagella associated protein 221
SynonymsGm101, Pcdp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119923341-119997234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119948113 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 449 (V449A)
Ref Sequence ENSEMBL: ENSMUSP00000037703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037840] [ENSMUST00000174370]
Predicted Effect probably benign
Transcript: ENSMUST00000037840
AA Change: V449A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037703
Gene: ENSMUSG00000036962
AA Change: V449A

DomainStartEndE-ValueType
low complexity region 292 301 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
low complexity region 754 771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174370
AA Change: V449A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134576
Gene: ENSMUSG00000036962
AA Change: V449A

DomainStartEndE-ValueType
low complexity region 292 301 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
low complexity region 754 771 N/A INTRINSIC
Meta Mutation Damage Score 0.1388 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Cfap221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cfap221 APN 1 119932845 missense possibly damaging 0.89
IGL00954:Cfap221 APN 1 119934209 missense probably damaging 1.00
IGL01340:Cfap221 APN 1 119953620 missense possibly damaging 0.76
IGL01413:Cfap221 APN 1 119985071 missense possibly damaging 0.84
IGL01418:Cfap221 APN 1 119985071 missense possibly damaging 0.84
IGL01730:Cfap221 APN 1 119934111 missense probably benign 0.01
IGL01931:Cfap221 APN 1 119932895 missense probably damaging 1.00
IGL02936:Cfap221 APN 1 119984752 missense probably damaging 1.00
IGL03309:Cfap221 APN 1 119934601 missense probably damaging 1.00
Ningxia UTSW 1 119953659 missense probably benign 0.08
R0365:Cfap221 UTSW 1 119985023 missense probably benign 0.00
R0396:Cfap221 UTSW 1 119954200 missense probably benign 0.00
R1505:Cfap221 UTSW 1 119953628 missense probably benign 0.04
R1740:Cfap221 UTSW 1 119945828 missense probably benign
R1873:Cfap221 UTSW 1 119953659 missense probably benign 0.08
R1875:Cfap221 UTSW 1 119953659 missense probably benign 0.08
R2205:Cfap221 UTSW 1 119936104 missense possibly damaging 0.76
R3885:Cfap221 UTSW 1 119954146 critical splice donor site probably null
R4290:Cfap221 UTSW 1 119930920 missense probably benign 0.00
R4856:Cfap221 UTSW 1 119934204 missense probably damaging 0.99
R4856:Cfap221 UTSW 1 119984758 missense probably damaging 0.99
R4886:Cfap221 UTSW 1 119934204 missense probably damaging 0.99
R4886:Cfap221 UTSW 1 119984758 missense probably damaging 0.99
R4890:Cfap221 UTSW 1 119955746 missense probably benign 0.01
R5623:Cfap221 UTSW 1 119954168 missense probably benign 0.00
R5644:Cfap221 UTSW 1 119932802 missense probably damaging 1.00
R5758:Cfap221 UTSW 1 119934558 missense probably benign 0.00
R5959:Cfap221 UTSW 1 119932781 missense probably damaging 1.00
R6145:Cfap221 UTSW 1 119984816 missense possibly damaging 0.92
R6186:Cfap221 UTSW 1 119934610 missense probably damaging 1.00
R6431:Cfap221 UTSW 1 119932853 missense probably damaging 1.00
R6700:Cfap221 UTSW 1 119955691 missense possibly damaging 0.71
R7109:Cfap221 UTSW 1 119925571 missense possibly damaging 0.92
R7273:Cfap221 UTSW 1 119954218 missense possibly damaging 0.83
R7343:Cfap221 UTSW 1 119995098 missense possibly damaging 0.92
R7486:Cfap221 UTSW 1 119923592 missense possibly damaging 0.71
X0017:Cfap221 UTSW 1 119961989 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGTGTGAATGGCATCTCTAATG -3'
(R):5'- GAGACTGTCTCAAGAAACAAGTGC -3'

Sequencing Primer
(F):5'- GAATGGCATCTCTAATGGTCTGTCC -3'
(R):5'- GCTGCTCTCAGTTTGAAGACCAAG -3'
Posted On2019-06-26