Incidental Mutation 'R7225:Rnf219'
ID562114
Institutional Source Beutler Lab
Gene Symbol Rnf219
Ensembl Gene ENSMUSG00000022120
Gene Namering finger protein 219
Synonyms2810449K13Rik, 2610206B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location104477536-104522645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104479858 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 360 (T360A)
Ref Sequence ENSEMBL: ENSMUSP00000022716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022716]
Predicted Effect probably benign
Transcript: ENSMUST00000022716
AA Change: T360A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022716
Gene: ENSMUSG00000022120
AA Change: T360A

DomainStartEndE-ValueType
RING 18 55 2.78e-3 SMART
coiled coil region 87 129 N/A INTRINSIC
coiled coil region 157 263 N/A INTRINSIC
low complexity region 302 319 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Rnf219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rnf219 APN 14 104479387 nonsense probably null
IGL01731:Rnf219 APN 14 104479302 missense probably damaging 1.00
I2505:Rnf219 UTSW 14 104503449 splice site probably benign
IGL03098:Rnf219 UTSW 14 104478817 missense possibly damaging 0.93
PIT4651001:Rnf219 UTSW 14 104506256 missense probably damaging 0.99
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0394:Rnf219 UTSW 14 104478853 missense possibly damaging 0.74
R0608:Rnf219 UTSW 14 104479527 missense probably damaging 1.00
R0727:Rnf219 UTSW 14 104480188 missense probably damaging 1.00
R1109:Rnf219 UTSW 14 104479764 nonsense probably null
R1774:Rnf219 UTSW 14 104479662 missense possibly damaging 0.68
R1922:Rnf219 UTSW 14 104479186 missense probably benign 0.02
R2018:Rnf219 UTSW 14 104522542 missense probably damaging 1.00
R2061:Rnf219 UTSW 14 104522532 splice site probably benign
R2182:Rnf219 UTSW 14 104506176 missense possibly damaging 0.55
R2336:Rnf219 UTSW 14 104478882 missense probably damaging 1.00
R4308:Rnf219 UTSW 14 104479593 missense probably damaging 0.97
R4355:Rnf219 UTSW 14 104479257 missense probably benign 0.01
R4703:Rnf219 UTSW 14 104506208 missense probably benign 0.03
R4738:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4739:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4869:Rnf219 UTSW 14 104478816 missense probably damaging 0.99
R5025:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5054:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5167:Rnf219 UTSW 14 104478787 missense probably damaging 1.00
R6356:Rnf219 UTSW 14 104478877 missense probably damaging 0.99
R6427:Rnf219 UTSW 14 104480226 missense possibly damaging 0.70
R6482:Rnf219 UTSW 14 104479817 nonsense probably null
R6518:Rnf219 UTSW 14 104479065 missense probably damaging 1.00
R6619:Rnf219 UTSW 14 104522557 missense possibly damaging 0.88
R6731:Rnf219 UTSW 14 104479474 missense probably benign 0.06
R6754:Rnf219 UTSW 14 104503414 missense probably damaging 1.00
R6812:Rnf219 UTSW 14 104510432 missense unknown
X0002:Rnf219 UTSW 14 104507977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCATTTGGAGAATCACAG -3'
(R):5'- AATCAGAGTGACAGTGCCAG -3'

Sequencing Primer
(F):5'- GCATTTGGAGAATCACAGAAATCATC -3'
(R):5'- CAGAAAGCAGGCTGGCTC -3'
Posted On2019-06-26