Incidental Mutation 'R7234:Cdkn3'
ID562717
Institutional Source Beutler Lab
Gene Symbol Cdkn3
Ensembl Gene ENSMUSG00000037628
Gene Namecyclin-dependent kinase inhibitor 3
Synonyms2410006H10Rik, KAP
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028222.1; MGI:1919641

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location46760541-46771669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46771461 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 204 (S204P)
Ref Sequence ENSEMBL: ENSMUSP00000070575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015903] [ENSMUST00000067426] [ENSMUST00000146629] [ENSMUST00000227149] [ENSMUST00000228106]
Predicted Effect probably benign
Transcript: ENSMUST00000015903
SMART Domains Protein: ENSMUSP00000015903
Gene: ENSMUSG00000015759

DomainStartEndE-ValueType
Pfam:Cornichon 1 136 3e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000067426
AA Change: S204P
SMART Domains Protein: ENSMUSP00000070575
Gene: ENSMUSG00000037628
AA Change: S204P

DomainStartEndE-ValueType
PTPc_DSPc 7 197 2.8e-3 SMART
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146629
SMART Domains Protein: ENSMUSP00000116885
Gene: ENSMUSG00000015759

DomainStartEndE-ValueType
Pfam:Cornichon 1 60 7.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227149
Predicted Effect probably benign
Transcript: ENSMUST00000228106
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Cdkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0374:Cdkn3 UTSW 14 46767173 splice site probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R0445:Cdkn3 UTSW 14 46767400 critical splice donor site probably null
R1912:Cdkn3 UTSW 14 46769834 critical splice acceptor site probably null
R3176:Cdkn3 UTSW 14 46771477 unclassified probably benign
R3276:Cdkn3 UTSW 14 46771477 unclassified probably benign
R4941:Cdkn3 UTSW 14 46769863 missense possibly damaging 0.90
R5344:Cdkn3 UTSW 14 46767350 missense possibly damaging 0.94
R5964:Cdkn3 UTSW 14 46767217 missense probably null 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R7073:Cdkn3 UTSW 14 46767190 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGTCTACAGAATCTGCCCCTCC -3'
(R):5'- CCCTCTGCTGTGATACAACACC -3'

Sequencing Primer
(F):5'- GCAGCCAGCATCTCCTC -3'
(R):5'- CCGAATTCATGACTCAAGCATTAGG -3'
Posted On2019-06-26