Incidental Mutation 'R7253:B020004J07Rik'
ID564058
Institutional Source Beutler Lab
Gene Symbol B020004J07Rik
Ensembl Gene ENSMUSG00000035201
Gene NameRIKEN cDNA B020004J07 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7253 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101834969-101844023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101835528 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 425 (V425E)
Ref Sequence ENSEMBL: ENSMUSP00000081421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084386] [ENSMUST00000106919]
Predicted Effect probably benign
Transcript: ENSMUST00000084386
AA Change: V425E

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081421
Gene: ENSMUSG00000035201
AA Change: V425E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106919
AA Change: V425E

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102532
Gene: ENSMUSG00000035201
AA Change: V425E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 H199R not run Het
Ak9 A G 10: 41,432,484 N1804S unknown Het
Akr1c21 C A 13: 4,577,140 T147N probably damaging Het
Aldh1a2 A G 9: 71,215,934 T30A probably benign Het
Alox15 T C 11: 70,345,898 D447G probably damaging Het
Amigo2 T C 15: 97,245,075 I489V probably benign Het
Ano9 A T 7: 141,107,437 Y322N probably damaging Het
Arhgap40 G T 2: 158,547,656 W583L probably benign Het
Atxn2 A G 5: 121,778,021 E430G probably damaging Het
Brip1 T C 11: 86,143,278 Y539C possibly damaging Het
C87436 T A 6: 86,465,808 L454Q probably damaging Het
Casp4 T G 9: 5,324,868 Y227D probably benign Het
Ccdc151 T C 9: 22,002,471 T2A probably damaging Het
Chrna10 A G 7: 102,112,086 C433R probably benign Het
Cntln A T 4: 85,118,473 N214I probably damaging Het
Colec12 G A 18: 9,848,922 V367I probably damaging Het
Cyp46a1 T C 12: 108,351,996 I222T probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Fam46a C A 9: 85,326,717 G18C probably benign Het
Glyctk T C 9: 106,155,462 T451A probably damaging Het
Hectd4 A G 5: 121,314,881 K484E possibly damaging Het
Hspg2 A C 4: 137,519,946 N1160T probably benign Het
Ighv5-8 C T 12: 113,655,108 L48F probably benign Het
Jazf1 C A 6: 52,777,652 E146D probably benign Het
Katnb1 C T 8: 95,095,497 Q284* probably null Het
Kctd18 G T 1: 57,961,956 Y213* probably null Het
Klk1b26 T C 7: 44,014,789 S23P possibly damaging Het
Krt88 T C 15: 101,450,511 L26P probably damaging Het
Lrrc8b G A 5: 105,481,656 V623I probably benign Het
Map3k4 T A 17: 12,272,068 M159L probably benign Het
Mast3 C A 8: 70,789,682 probably null Het
Mrpl46 T C 7: 78,781,459 D117G probably damaging Het
Ms4a6b A G 19: 11,520,396 S20G probably benign Het
Mup10 A T 4: 60,582,078 M4K unknown Het
Nlrp5 C T 7: 23,417,391 A180V possibly damaging Het
Olfr1195 T C 2: 88,683,625 T36A possibly damaging Het
Olfr313 T A 11: 58,817,540 C177* probably null Het
Olfr315 T C 11: 58,778,996 Y290H probably damaging Het
Olfr437 T C 6: 43,167,810 F251L probably damaging Het
Olfr612 C T 7: 103,538,788 A149T probably benign Het
Olfr992 A G 2: 85,399,639 I298T probably benign Het
Otud1 C A 2: 19,658,931 D290E probably damaging Het
Pank4 A G 4: 154,970,920 N249S probably benign Het
Pccb G T 9: 101,031,913 S84R probably benign Het
Pemt A T 11: 59,971,255 H194Q possibly damaging Het
Phtf2 A G 5: 20,765,858 I634T possibly damaging Het
Pias2 T G 18: 77,120,115 I232R probably damaging Het
Plce1 A G 19: 38,698,508 E620G probably damaging Het
Ptpn13 G A 5: 103,565,284 E1758K possibly damaging Het
Ptprq T A 10: 107,608,273 Q1490L probably benign Het
Ptx3 G T 3: 66,224,947 M296I probably benign Het
R3hdm2 C T 10: 127,481,775 P464L probably damaging Het
Rapgef1 A G 2: 29,699,721 E258G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Senp8 T C 9: 59,737,195 N226S probably benign Het
Six5 C T 7: 19,094,976 R114C probably damaging Het
Slc10a1 T C 12: 80,958,184 T195A probably benign Het
Slpi G T 2: 164,355,547 Q51K probably benign Het
Smarca4 T C 9: 21,658,960 V753A probably benign Het
Tbc1d32 C A 10: 56,198,441 M225I probably benign Het
Tnfrsf21 G A 17: 43,037,667 V57I probably benign Het
Trim44 G T 2: 102,346,968 P336T possibly damaging Het
Txlnb A G 10: 17,827,885 I264V probably damaging Het
Wisp3 T G 10: 39,155,035 N164T probably benign Het
Xirp2 A C 2: 67,513,482 E2022D probably benign Het
Zfp975 A G 7: 42,661,612 *526R probably null Het
Zp1 A G 19: 10,916,569 L424P probably damaging Het
Other mutations in B020004J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:B020004J07Rik APN 4 101835532 missense probably benign
IGL01615:B020004J07Rik APN 4 101837004 missense possibly damaging 0.63
IGL01765:B020004J07Rik APN 4 101837852 missense probably benign 0.03
IGL02228:B020004J07Rik APN 4 101836858 missense probably benign 0.03
IGL02276:B020004J07Rik APN 4 101838109 missense possibly damaging 0.89
IGL02548:B020004J07Rik APN 4 101835573 missense probably damaging 0.99
IGL03226:B020004J07Rik APN 4 101835397 missense probably benign 0.00
R0124:B020004J07Rik UTSW 4 101835373 makesense probably null
R0449:B020004J07Rik UTSW 4 101836961 missense probably benign 0.01
R0573:B020004J07Rik UTSW 4 101835414 missense probably damaging 0.96
R1159:B020004J07Rik UTSW 4 101838027 missense possibly damaging 0.54
R1689:B020004J07Rik UTSW 4 101837179 missense possibly damaging 0.63
R1857:B020004J07Rik UTSW 4 101835573 missense probably damaging 1.00
R1861:B020004J07Rik UTSW 4 101836938 missense probably benign
R2570:B020004J07Rik UTSW 4 101837246 missense probably benign 0.01
R3886:B020004J07Rik UTSW 4 101835723 missense probably benign 0.09
R4922:B020004J07Rik UTSW 4 101835532 missense probably benign
R4984:B020004J07Rik UTSW 4 101835599 missense possibly damaging 0.63
R5503:B020004J07Rik UTSW 4 101835802 missense probably benign 0.00
R6230:B020004J07Rik UTSW 4 101837214 missense probably damaging 0.96
R6831:B020004J07Rik UTSW 4 101836897 missense probably benign 0.26
R7172:B020004J07Rik UTSW 4 101836996 missense probably benign 0.00
R7201:B020004J07Rik UTSW 4 101838141 critical splice acceptor site probably null
R7220:B020004J07Rik UTSW 4 101837368 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTTGAATTCTGGGACTCTG -3'
(R):5'- TTGCCTGCCTTGATCCAGTG -3'

Sequencing Primer
(F):5'- AGATTTCATTTCCCAGCATCCAG -3'
(R):5'- TGATCCAGTGCTCCCAGC -3'
Posted On2019-06-26