Incidental Mutation 'R7329:Rfc1'
ID569102
Institutional Source Beutler Lab
Gene Symbol Rfc1
Ensembl Gene ENSMUSG00000029191
Gene Namereplication factor C (activator 1) 1
Synonyms140kDa, Recc1, Alp145, RFC140
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7329 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65261850-65335670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65263135 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1122 (R1122S)
Ref Sequence ENSEMBL: ENSMUSP00000145385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000203596] [ENSMUST00000203653] [ENSMUST00000204965]
Predicted Effect probably benign
Transcript: ENSMUST00000041892
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172732
AA Change: R1107S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: R1107S

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 5.2e-62 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203471
AA Change: R1109S
SMART Domains Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: R1109S

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203554
Predicted Effect unknown
Transcript: ENSMUST00000203581
AA Change: R1122S
SMART Domains Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: R1122S

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
BRCT 415 493 7.39e-17 SMART
low complexity region 498 516 N/A INTRINSIC
AAA 640 775 9.65e-10 SMART
Pfam:RFC1 912 1065 2.6e-61 PFAM
low complexity region 1117 1145 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203596
AA Change: R193S
SMART Domains Protein: ENSMUSP00000145181
Gene: ENSMUSG00000029191
AA Change: R193S

DomainStartEndE-ValueType
Pfam:RFC1 2 137 1.7e-46 PFAM
low complexity region 189 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203653
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204965
AA Change: R1108S
SMART Domains Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: R1108S

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Rfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Rfc1 APN 5 65296009 missense probably benign 0.00
IGL00909:Rfc1 APN 5 65279699 missense probably benign 0.00
IGL01791:Rfc1 APN 5 65263145 missense probably benign 0.00
IGL01884:Rfc1 APN 5 65274460 missense possibly damaging 0.94
IGL02737:Rfc1 APN 5 65311163 missense possibly damaging 0.82
Disturbing UTSW 5 65266162 missense probably damaging 1.00
P0038:Rfc1 UTSW 5 65287961 missense probably damaging 1.00
R0317:Rfc1 UTSW 5 65296052 splice site probably null
R0452:Rfc1 UTSW 5 65264297 missense probably benign 0.01
R0699:Rfc1 UTSW 5 65319399 splice site probably null
R0945:Rfc1 UTSW 5 65278709 critical splice donor site probably null
R1192:Rfc1 UTSW 5 65293911 missense probably benign 0.03
R1341:Rfc1 UTSW 5 65291194 missense probably damaging 1.00
R1425:Rfc1 UTSW 5 65319518 missense probably damaging 1.00
R1551:Rfc1 UTSW 5 65277363 missense probably damaging 0.99
R1800:Rfc1 UTSW 5 65264379 missense probably damaging 1.00
R1969:Rfc1 UTSW 5 65319524 missense probably damaging 1.00
R2006:Rfc1 UTSW 5 65311054 nonsense probably null
R2026:Rfc1 UTSW 5 65288029 missense probably damaging 1.00
R2073:Rfc1 UTSW 5 65301939 missense probably damaging 0.98
R2137:Rfc1 UTSW 5 65311039 critical splice donor site probably null
R2330:Rfc1 UTSW 5 65312969 missense possibly damaging 0.94
R3774:Rfc1 UTSW 5 65264406 missense probably damaging 1.00
R3787:Rfc1 UTSW 5 65296014 missense probably benign 0.00
R4920:Rfc1 UTSW 5 65287928 missense probably damaging 1.00
R5055:Rfc1 UTSW 5 65266162 missense probably damaging 1.00
R5308:Rfc1 UTSW 5 65279461 missense probably damaging 0.99
R5723:Rfc1 UTSW 5 65277426 missense probably null 0.78
R5729:Rfc1 UTSW 5 65277452 missense probably damaging 1.00
R5844:Rfc1 UTSW 5 65293787 missense probably benign 0.19
R6045:Rfc1 UTSW 5 65279549 missense probably damaging 1.00
R6484:Rfc1 UTSW 5 65293677 missense probably benign 0.01
R6495:Rfc1 UTSW 5 65273815 intron probably null
R6531:Rfc1 UTSW 5 65312979 missense possibly damaging 0.92
R6717:Rfc1 UTSW 5 65302004 nonsense probably null
R6717:Rfc1 UTSW 5 65312961 missense probably damaging 0.97
R6845:Rfc1 UTSW 5 65311116 missense possibly damaging 0.53
R6880:Rfc1 UTSW 5 65277386 missense probably benign 0.14
R7331:Rfc1 UTSW 5 65311044 missense probably damaging 1.00
R7466:Rfc1 UTSW 5 65275426 missense probably damaging 1.00
R7497:Rfc1 UTSW 5 65279498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTACCGTCCTTTATAATGGG -3'
(R):5'- GCAATTCCTGTGCTGTTGCC -3'

Sequencing Primer
(F):5'- GCTGTGCTACACCAAACTTG -3'
(R):5'- TTGCCTTTCAGGACGAGAGC -3'
Posted On2019-09-13