Incidental Mutation 'R0008:Arrdc3'
ID58255
Institutional Source Beutler Lab
Gene Symbol Arrdc3
Ensembl Gene ENSMUSG00000074794
Gene Namearrestin domain containing 3
SynonymsmKIAA1376; AI450344
MMRRC Submission 038303-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R0008 (G1)
Quality Score194
Status Validated
Chromosome13
Chromosomal Location80883384-80896042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80891075 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 75 (I75N)
Ref Sequence ENSEMBL: ENSMUSP00000125455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099356] [ENSMUST00000159690] [ENSMUST00000161441]
Predicted Effect probably damaging
Transcript: ENSMUST00000099356
AA Change: I295N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096957
Gene: ENSMUSG00000074794
AA Change: I295N

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.4e-35 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159090
Predicted Effect probably damaging
Transcript: ENSMUST00000159690
AA Change: I295N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124418
Gene: ENSMUSG00000074794
AA Change: I295N

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.5e-38 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159856
Predicted Effect probably damaging
Transcript: ENSMUST00000161441
AA Change: I75N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125455
Gene: ENSMUSG00000074794
AA Change: I75N

DomainStartEndE-ValueType
Pfam:Arrestin_C 4 94 2e-10 PFAM
low complexity region 99 111 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162904
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arrestin family of proteins, which regulate G protein-mediated signaling. The encoded protein is thought to act as a regulator of breast cancer growth and progression by binding to a phosphorylated form of integrin beta4, a tumor-related antigen, targeting the integrin for internalization and degradation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit resistance to age-related obesity, insulin resistance, and hepatic steatosis. Mice homozygous for a different gene trap allele exhibit resistance to obesity, embryonic lethality when dams are fed a standard chow and dandruff due to very thin skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Cp T A 3: 19,968,123 Y230N probably damaging Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Lrp6 T C 6: 134,485,753 E648G probably damaging Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prep T C 10: 45,115,078 V280A probably benign Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Rnf213 A C 11: 119,465,052 E4108A possibly damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Sh2d3c C G 2: 32,753,021 H587D probably damaging Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slc9b2 T A 3: 135,336,508 V516D possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vps13c T C 9: 67,919,262 V1395A probably benign Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Arrdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Arrdc3 APN 13 80890572 missense probably damaging 1.00
IGL00933:Arrdc3 APN 13 80891055 splice site probably benign
IGL02006:Arrdc3 APN 13 80883774 missense probably damaging 1.00
IGL02009:Arrdc3 APN 13 80893380 missense probably benign 0.20
IGL02272:Arrdc3 APN 13 80891650 splice site probably benign
IGL02634:Arrdc3 APN 13 80890765 missense probably damaging 1.00
IGL03337:Arrdc3 APN 13 80890647 missense probably benign 0.01
R0008:Arrdc3 UTSW 13 80891075 missense probably damaging 1.00
R0008:Arrdc3 UTSW 13 80883892 nonsense probably null
R0838:Arrdc3 UTSW 13 80889247 splice site probably benign
R0843:Arrdc3 UTSW 13 80890803 splice site probably benign
R1211:Arrdc3 UTSW 13 80890698 missense possibly damaging 0.76
R1404:Arrdc3 UTSW 13 80883854 missense probably damaging 1.00
R1404:Arrdc3 UTSW 13 80883854 missense probably damaging 1.00
R1992:Arrdc3 UTSW 13 80883689 missense probably damaging 1.00
R4446:Arrdc3 UTSW 13 80889063 intron probably benign
R4540:Arrdc3 UTSW 13 80890671 missense possibly damaging 0.95
R4718:Arrdc3 UTSW 13 80883867 missense possibly damaging 0.48
R5138:Arrdc3 UTSW 13 80891065 missense probably damaging 1.00
R5814:Arrdc3 UTSW 13 80890579 missense possibly damaging 0.92
R6514:Arrdc3 UTSW 13 80889190 missense probably damaging 1.00
R6899:Arrdc3 UTSW 13 80889211 missense probably damaging 0.99
R6985:Arrdc3 UTSW 13 80883657 missense probably damaging 0.99
R7076:Arrdc3 UTSW 13 80890696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTCATAAGCCTAGAACATGGCACAT -3'
(R):5'- GCACCCACTGGGGCGAGATTATT -3'

Sequencing Primer
(F):5'- GCCTAGAACATGGCACATAAAAG -3'
(R):5'- TACAACCTCTGCATAGCTGGG -3'
Posted On2013-07-11