Incidental Mutation 'R0008:Rnf213'
ID58244
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 038303-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0008 (G1)
Quality Score200
Status Validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119465052 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 4108 (E4108A)
Ref Sequence ENSEMBL: ENSMUSP00000091429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093902
AA Change: E4108A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: E4108A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131035
AA Change: E4107A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: E4107A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208476
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Arrdc3 T A 13: 80,883,892 Y81* probably null Het
Arrdc3 T A 13: 80,891,075 I75N probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Cp T A 3: 19,968,123 Y230N probably damaging Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Lrp6 T C 6: 134,485,753 E648G probably damaging Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prep T C 10: 45,115,078 V280A probably benign Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Sh2d3c C G 2: 32,753,021 H587D probably damaging Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slc9b2 T A 3: 135,336,508 V516D possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vps13c T C 9: 67,919,262 V1395A probably benign Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
dinky UTSW 11 119416458 missense probably damaging 0.99
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GACCAGTCATGTGTGTCAGATCCAG -3'
(R):5'- ACTATATACCAATGGTGGGCGGGG -3'

Sequencing Primer
(F):5'- GTGTCAGATCCAGGTGCTG -3'
(R):5'- tgtttgtttgttttctttgtttttCC -3'
Posted On2013-07-11