Incidental Mutation 'R0008:Cp'
ID58195
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
SynonymsD3Ertd555e
MMRRC Submission 038303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0008 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19968123 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 230 (Y230N)
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
Predicted Effect probably damaging
Transcript: ENSMUST00000003714
AA Change: Y230N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: Y230N

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091309
AA Change: Y230N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: Y230N

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108325
AA Change: Y230N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: Y230N

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108328
AA Change: Y230N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: Y230N

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108329
AA Change: Y230N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: Y230N

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174803
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Arrdc3 T A 13: 80,883,892 Y81* probably null Het
Arrdc3 T A 13: 80,891,075 I75N probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Lrp6 T C 6: 134,485,753 E648G probably damaging Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prep T C 10: 45,115,078 V280A probably benign Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Rnf213 A C 11: 119,465,052 E4108A possibly damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Sh2d3c C G 2: 32,753,021 H587D probably damaging Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slc9b2 T A 3: 135,336,508 V516D possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vps13c T C 9: 67,919,262 V1395A probably benign Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1733:Cp UTSW 3 19968219 splice site probably benign
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1816:Cp UTSW 3 19968220 splice site probably benign
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R2249:Cp UTSW 3 19987570 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4724:Cp UTSW 3 19972647 missense probably benign 0.02
R4910:Cp UTSW 3 19989224 unclassified probably benign
R4960:Cp UTSW 3 19973797 missense probably damaging 0.96
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5404:Cp UTSW 3 19989128 missense possibly damaging 0.92
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5789:Cp UTSW 3 19957290 missense probably benign
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense probably damaging 1.00
R7136:Cp UTSW 3 19985658 nonsense probably null
R7212:Cp UTSW 3 19974966 missense probably damaging 1.00
R7269:Cp UTSW 3 19983477 missense probably damaging 1.00
R7316:Cp UTSW 3 19972752 missense probably damaging 1.00
R7336:Cp UTSW 3 19964532 splice site probably null
R7361:Cp UTSW 3 19964306 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCTTCCACAAAGTGGAGTGGATGGTAA -3'
(R):5'- AGGGCTTCAGGCTAGAAGTATTCATGT -3'

Sequencing Primer
(F):5'- TGGATGGTAAACACCTGTGTACTAAG -3'
(R):5'- CCTGTTGCTTTCCTGGAAGTCTT -3'
Posted On2013-07-11