Mutagenetix > Incidental Mutation

Incidental Mutation 'R0678:Sec31a'

61705

Institutional Source

Beutler Lab

Gene Symbol

Sec31a

Ensembl Gene

ENSMUSG00000035325

Gene Name

SEC31 homolog A, COPII coat complex component

Synonyms

1810024J13Rik, Sec31l1

MMRRC Submission

038863-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.855) question?

Stock #

R0678 (G1)

Quality Score

105

Status

Not validated

Chromosome

Chromosomal Location

100509508-100564093 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100555084 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 45 (I45M)

Ref Sequence

ENSEMBL: ENSMUSP00000138213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886]

AlphaFold

Q3UPL0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094578
AA Change: I45M

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: I45M

Domain	Start	End	E-Value	Type
WD40	56	102	1.59e1	SMART
WD40	111	151	5.15e-2	SMART
WD40	158	197	5.16e-1	SMART
WD40	200	245	6.63e0	SMART
WD40	249	289	1.95e-2	SMART
WD40	292	332	4.24e-3	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	572	769	3.5e-7	PFAM
low complexity region	866	882	N/A	INTRINSIC
low complexity region	930	949	N/A	INTRINSIC
low complexity region	953	975	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182171

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182850

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182886
AA Change: I45M

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: I45M

Domain	Start	End	E-Value	Type
WD40	56	102	1e-1	SMART
WD40	111	151	3.3e-4	SMART
WD40	158	197	3.2e-3	SMART
WD40	200	245	4.1e-2	SMART
WD40	249	289	1.2e-4	SMART
WD40	292	332	2.6e-5	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	532	731	2.1e-6	PFAM
low complexity region	827	843	N/A	INTRINSIC
low complexity region	891	910	N/A	INTRINSIC
low complexity region	914	936	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Egfl7	C	T	2: 26,480,952 (GRCm39)	R155C	probably benign	Het
Fat4	T	C	3: 38,943,843 (GRCm39)	I912T	probably damaging	Het
H2-M5	A	G	17: 37,300,034 (GRCm39)	F47L	possibly damaging	Het
H2-T24	A	T	17: 36,328,333 (GRCm39)	F50Y	probably damaging	Het
Hif1a	A	G	12: 73,990,965 (GRCm39)		probably null	Het
Ints11	T	C	4: 155,972,210 (GRCm39)	I405T	probably damaging	Het
Kmt2d	A	T	15: 98,748,294 (GRCm39)		probably benign	Het
Pld1	T	A	3: 28,174,933 (GRCm39)	V857D	probably damaging	Het
Ptgr3	A	G	18: 84,113,287 (GRCm39)	E321G	probably benign	Het
Rab11fip3	G	A	17: 26,287,821 (GRCm39)	P111S	probably benign	Het
Rad17	A	T	13: 100,781,692 (GRCm39)	I35N	possibly damaging	Het
Rnf31	C	A	14: 55,839,170 (GRCm39)	Y66*	probably null	Het
Sele	T	C	1: 163,882,298 (GRCm39)		probably null	Het
Serpina3i	G	T	12: 104,232,978 (GRCm39)		probably null	Het
Sp6	T	A	11: 96,912,607 (GRCm39)	W107R	probably damaging	Het
Sphkap	A	T	1: 83,256,349 (GRCm39)	W467R	probably benign	Het
Thbs1	T	C	2: 117,953,387 (GRCm39)	F935L	probably damaging	Het
Vmn2r8	T	A	5: 108,948,412 (GRCm39)	H492L	probably benign	Het
Xrcc2	A	G	5: 25,903,261 (GRCm39)	S37P	possibly damaging	Het
Zfand1	T	A	3: 10,413,577 (GRCm39)	I31L	probably benign	Het
Zfr	G	A	15: 12,184,171 (GRCm39)	D1058N	probably damaging	Het

Other mutations in Sec31a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Sec31a	APN	5	100,551,876 (GRCm39)	nonsense	probably null
IGL01610:Sec31a	APN	5	100,550,217 (GRCm39)	splice site	probably benign
IGL01804:Sec31a	APN	5	100,523,065 (GRCm39)	critical splice donor site	probably null
IGL02026:Sec31a	APN	5	100,517,485 (GRCm39)	missense	probably benign	0.04
IGL02150:Sec31a	APN	5	100,533,984 (GRCm39)	splice site	probably benign
IGL02237:Sec31a	APN	5	100,509,914 (GRCm39)	missense	probably damaging	1.00
IGL02469:Sec31a	APN	5	100,533,114 (GRCm39)	missense	probably benign	0.02
IGL02512:Sec31a	APN	5	100,555,052 (GRCm39)	missense	probably damaging	0.99
control	UTSW	5	100,510,032 (GRCm39)	missense	probably damaging	1.00
D3080:Sec31a	UTSW	5	100,511,691 (GRCm39)	missense	probably damaging	1.00
PIT4142001:Sec31a	UTSW	5	100,555,134 (GRCm39)	missense	probably damaging	1.00
R0366:Sec31a	UTSW	5	100,530,625 (GRCm39)	missense	probably damaging	1.00
R0453:Sec31a	UTSW	5	100,551,977 (GRCm39)	splice site	probably benign
R0511:Sec31a	UTSW	5	100,523,099 (GRCm39)	missense	probably benign	0.01
R0546:Sec31a	UTSW	5	100,551,929 (GRCm39)	missense	probably damaging	1.00
R0675:Sec31a	UTSW	5	100,541,066 (GRCm39)	missense	probably damaging	0.97
R0975:Sec31a	UTSW	5	100,543,763 (GRCm39)	splice site	probably null
R1146:Sec31a	UTSW	5	100,510,032 (GRCm39)	missense	probably damaging	1.00
R1146:Sec31a	UTSW	5	100,510,032 (GRCm39)	missense	probably damaging	1.00
R1540:Sec31a	UTSW	5	100,523,178 (GRCm39)	missense	probably damaging	1.00
R1616:Sec31a	UTSW	5	100,534,054 (GRCm39)	missense	possibly damaging	0.88
R1780:Sec31a	UTSW	5	100,529,195 (GRCm39)	splice site	probably null
R2472:Sec31a	UTSW	5	100,533,064 (GRCm39)	missense	probably damaging	1.00
R3689:Sec31a	UTSW	5	100,530,766 (GRCm39)	missense	probably damaging	1.00
R4515:Sec31a	UTSW	5	100,513,817 (GRCm39)	missense	probably damaging	0.99
R4801:Sec31a	UTSW	5	100,541,222 (GRCm39)	missense	probably damaging	0.96
R4802:Sec31a	UTSW	5	100,541,222 (GRCm39)	missense	probably damaging	0.96
R4896:Sec31a	UTSW	5	100,516,192 (GRCm39)	missense	probably damaging	1.00
R5004:Sec31a	UTSW	5	100,516,192 (GRCm39)	missense	probably damaging	1.00
R5053:Sec31a	UTSW	5	100,541,073 (GRCm39)	missense	possibly damaging	0.94
R5158:Sec31a	UTSW	5	100,541,180 (GRCm39)	missense	probably damaging	0.99
R5191:Sec31a	UTSW	5	100,553,370 (GRCm39)	missense	possibly damaging	0.75
R5222:Sec31a	UTSW	5	100,530,754 (GRCm39)	missense	probably benign
R5405:Sec31a	UTSW	5	100,531,657 (GRCm39)	nonsense	probably null
R5436:Sec31a	UTSW	5	100,511,698 (GRCm39)	missense	probably damaging	0.98
R5577:Sec31a	UTSW	5	100,550,133 (GRCm39)	missense	possibly damaging	0.95
R6005:Sec31a	UTSW	5	100,511,737 (GRCm39)	missense	probably damaging	1.00
R6184:Sec31a	UTSW	5	100,517,453 (GRCm39)	critical splice donor site	probably null
R6245:Sec31a	UTSW	5	100,534,043 (GRCm39)	missense	probably benign	0.07
R6475:Sec31a	UTSW	5	100,533,129 (GRCm39)	missense	probably damaging	1.00
R6476:Sec31a	UTSW	5	100,534,008 (GRCm39)	missense	probably benign	0.03
R6744:Sec31a	UTSW	5	100,540,358 (GRCm39)	missense	possibly damaging	0.47
R6804:Sec31a	UTSW	5	100,530,671 (GRCm39)	missense	probably benign	0.03
R6911:Sec31a	UTSW	5	100,541,123 (GRCm39)	missense	possibly damaging	0.92
R6936:Sec31a	UTSW	5	100,540,369 (GRCm39)	missense	probably benign
R7345:Sec31a	UTSW	5	100,533,129 (GRCm39)	missense	probably damaging	1.00
R7760:Sec31a	UTSW	5	100,540,487 (GRCm39)	missense	probably damaging	1.00
R7898:Sec31a	UTSW	5	100,547,336 (GRCm39)	missense	probably damaging	0.99
R8088:Sec31a	UTSW	5	100,526,721 (GRCm39)	missense
R8555:Sec31a	UTSW	5	100,540,273 (GRCm39)	missense	probably benign	0.25
R8762:Sec31a	UTSW	5	100,526,688 (GRCm39)	missense
R9055:Sec31a	UTSW	5	100,534,040 (GRCm39)	missense	possibly damaging	0.75
R9173:Sec31a	UTSW	5	100,529,147 (GRCm39)	missense	possibly damaging	0.85
R9249:Sec31a	UTSW	5	100,533,083 (GRCm39)	missense	probably damaging	0.98
X0003:Sec31a	UTSW	5	100,547,213 (GRCm39)	missense	probably damaging	0.98
Z1177:Sec31a	UTSW	5	100,531,704 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCGCACACACCCCTCTC -3'
(R):5'- CTCATTTAGCCATGCTCAGGGTTGT -3'

Sequencing Primer
(F):5'- tgacaaagaggcaggaagag -3'
(R):5'- CTCAGGGTTGTATGTGCTGAGG -3'

Posted On

2013-07-30