Incidental Mutation 'R0668:Uhrf1bp1'
ID62109
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
MMRRC Submission 038853-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0668 (G1)
Quality Score153
Status Not validated
Chromosome17
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27895939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1408 (I1408F)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect probably benign
Transcript: ENSMUST00000114849
AA Change: I1408F

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: I1408F

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137825
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,263,614 Q2149K probably damaging Het
Aifm1 T C X: 48,494,791 Q210R probably benign Het
Arhgef1 A G 7: 24,907,920 N31D possibly damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Cfb G T 17: 34,857,103 Q1176K probably benign Het
Chdh A G 14: 30,035,880 H447R probably damaging Het
Cpd A C 11: 76,784,398 V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 probably null Het
Dnhd1 A G 7: 105,695,751 T2101A probably benign Het
Fchsd2 A G 7: 101,196,920 K188E possibly damaging Het
Gm10549 A G 18: 33,470,850 T129A unknown Het
Gm11639 A T 11: 104,720,492 I387F probably benign Het
Gm15448 G A 7: 3,822,700 T390I probably damaging Het
Jph1 T A 1: 17,091,671 T256S probably damaging Het
Kcnma1 A G 14: 23,367,495 Y768H probably damaging Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Ly6g6d G A 17: 35,071,739 H72Y probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr95 T A 17: 37,211,644 I70F probably damaging Het
Sart1 T C 19: 5,384,256 Y249C probably damaging Het
Scin A G 12: 40,080,949 Y322H probably damaging Het
Slc44a3 T C 3: 121,510,203 T295A probably damaging Het
Slc4a5 T A 6: 83,271,072 L535Q probably damaging Het
Them5 A T 3: 94,344,413 K110N probably benign Het
Vmn1r32 T A 6: 66,553,660 Q44L possibly damaging Het
Vmn2r93 T A 17: 18,298,405 M42K probably benign Het
Zfp143 A T 7: 110,061,274 probably benign Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0167:Uhrf1bp1 UTSW 17 27880202 missense possibly damaging 0.46
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R0964:Uhrf1bp1 UTSW 17 27887178 missense probably damaging 0.96
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1341:Uhrf1bp1 UTSW 17 27877419 splice site probably benign
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1552:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1726:Uhrf1bp1 UTSW 17 27886251 splice site probably null
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4431:Uhrf1bp1 UTSW 17 27885931 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 intron probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 intron probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
R7082:Uhrf1bp1 UTSW 17 27890065 missense not run
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAACTGCACACAGGAGTTGGTAGG -3'
(R):5'- ACAAGGCTACGTAATGGCAAGACAC -3'

Sequencing Primer
(F):5'- GCAGAGAGCCCTAGTTACTTG -3'
(R):5'- GGACACAGCCACCCTCTG -3'
Posted On2013-07-30