Incidental Mutation 'R0701:Mcur1'
ID63027
Institutional Source Beutler Lab
Gene Symbol Mcur1
Ensembl Gene ENSMUSG00000021371
Gene Namemitochondrial calcium uniporter regulator 1
Synonyms6230416A05Rik, Ccdc90a
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0701 (G1)
Quality Score169
Status Not validated
Chromosome13
Chromosomal Location43538393-43560191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43545740 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 267 (Y267C)
Ref Sequence ENSEMBL: ENSMUSP00000021800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021800]
Predicted Effect probably damaging
Transcript: ENSMUST00000021800
AA Change: Y267C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021800
Gene: ENSMUSG00000021371
AA Change: Y267C

DomainStartEndE-ValueType
low complexity region 48 80 N/A INTRINSIC
low complexity region 85 125 N/A INTRINSIC
Pfam:DUF1640 147 339 3.7e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223353
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, reduced body size and impaired mitochondrial calcium uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Mcur1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Mcur1 APN 13 43541727 missense probably damaging 1.00
R0197:Mcur1 UTSW 13 43545740 missense probably damaging 1.00
R1085:Mcur1 UTSW 13 43555004 missense unknown
R1793:Mcur1 UTSW 13 43560015 missense unknown
R2418:Mcur1 UTSW 13 43549537 missense possibly damaging 0.91
R2419:Mcur1 UTSW 13 43549537 missense possibly damaging 0.91
R2508:Mcur1 UTSW 13 43544465 missense probably damaging 1.00
R4535:Mcur1 UTSW 13 43544540 missense probably damaging 1.00
R4817:Mcur1 UTSW 13 43551671 missense possibly damaging 0.92
R6542:Mcur1 UTSW 13 43551658 missense probably damaging 1.00
R7137:Mcur1 UTSW 13 43544455 critical splice donor site probably null
R7177:Mcur1 UTSW 13 43544536 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATCGTCCTGTGACATGCCAGAC -3'
(R):5'- ACCACACCATCAATGCCTTGGTTTC -3'

Sequencing Primer
(F):5'- CATGCCAGACGTTGGTTAAAAAC -3'
(R):5'- agagaacccaaccatcaacac -3'
Posted On2013-07-30